Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T26A8.4   

sjj_T26A8.4 RNAi JA:T26A8.4
Simmer:T26A8.4
PF:GL1_2C3
PCR_productsjj_T26A8.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST26A8.4 Source_evidenceePCR987WS150 Sequence/Annotation Release
Overlaps_Gene T26A8.4 Source_evidenceePCR987WS150 Sequence/Annotation Release
Chunk_score Abs_score924
Max_abs_score924T26A8.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV84294628430547
Overlaps_transcriptT26A8.4 Source_evidenceePCR987WS150 Sequence/Annotation Release
WB_DNA_textsjj_T26A8.41086ctctttctgtgcccgaagtcttggatctgatacggcattccctccagcgcccagcaatgagctgaaagcatcaaactgtttggcgattgctttggctcttcttggatcattggcagctatacgatcagggttctcaacatttgagtacggaagtcgcctttgaacacgaactagtccccaagtgacttgcactgtttgtggtatgactgctacacgattcgatgatccaaacatgctggaatagttggacggaggaggcgaggctggagaatcgtcgaccacgttgttccgaggacttgatatgagcttttcgccattggccatcttgttaagcattgcctgaaaaataaatattgttaaatgaaagctttctcaatattcttacctctaaattgaatccttgtggtgatgcagtatgtcgttcttgagagactatttgcggtggctgaactaatccaggctgctgaagatgtggatgttgaattggaactggatgcataggcctcattagttgtggttgctgttgatgcattataggaggagtttgagtactcagcctaggtggctcaattgttcgtggcggtggaagtccttgaacttgttcgggccgtggcccttgattgaaatatcctccagctgctggagcaacagggtattgctgatgtattggaattcctggtccagggtttcgttgaatggttggcacaacaactgctggtggtggaagttgacttggatgagatgcttgagggatcggagcatgtatcacaggcgttgcgtggggtggagatgaaccattcatattagggcctgaacatttttgaataattattatggaaaagtgatttcgattttctgcttacctccagggaggagaactctccttcttggcattacttgtgcagctgcagcggcagcagcagcatttgccactggattctgtctgtatgtttgagcctgctgcgcttgatgagcctgccgggcttcttcgtctgctagaatcttctcaatgattggtcgggtatagtccgtcaggggaacgtgagaaaatctacatggatcatggttgcattgtcctttgtggaa