Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T26E3.2   

sjj_T26E3.2RNAiJA:T26E3.2
PCR_productsjj_T26E3.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST26E3.2 Source_evidenceePCR846WS150 Sequence/Annotation Release
Overlaps_Gene T26E3.2 Source_evidenceePCR846WS150 Sequence/Annotation Release
Chunk_score Abs_score699
Max_abs_score699T26E3.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1267905712681115
Overlaps_transcriptT26E3.2 Source_evidenceePCR846WS150 Sequence/Annotation Release
WB_DNA_textsjj_T26E3.22059tcttgagattaccaactcctccagaatcccactacaccatccgtgcacttttttgtcaaaaaattttttcgcgtttcggaaccattttcttgtaaaaatttcgtcagatatatcagttttaccaatttttattccagaaaaatgccacttggaaagttggacctagtcgaagaggagtacatcgccgaaagcggagatcacacgccagaagcctcccggcttatgggaaatggtgattctgtagttggtaagcctttgaactgataggaatctggaaattatagaagtttccagaaaacttgaatggtcacacaaatggggcagttgcgaagaagaaaaatgagccaagggtgccggatatgcagttgggcagtgagtttttcaaggttttttgttgtaaatttgatacttgaaaaacctttttgaatgaaaaaaaaataataaaaaaaaacaaatttttaaaaacctaaatattccagaatgtcgctatgtaaggttacatgacaatgtaaactatgtcgctgctgcaattattctacggaaccagggagacgacacagaggtaatttttatttgcggcgatgggtctcgaaacgaaaaagctttagtagctcagcccaaaaaatgattttttataaaattcaaatttccaggtgctcctaatccaagaggccaagaaaagttgtcgtgggaaatggtatatgcctgccggacgggtagaagctggtgagacaattgaagaagcagtggtacgagaggttaaagaggagactgggtacagttgtgatgttgtggaactcctgtcactacaagttcaaggatccggatggtatcgatatgctttttattgtaatattacaggtgagaactcagtgagcttatttatttttctattaaaaatttgaattttcgccaaaaatgttccttaaaaatttgaatttcccgccaaaaactctcaggttcaggcattttatttgtagaaatttgaactaaattctgcaaattttgaccacaatttttgaattttttacctaatttacaacttttgagcaaaattcgtacctttagacccaattctgttagttttgctctaaatgtttcaaaattaaaccctcaccactatgagcgtgatattttgaaacgttttcagtgaatatagctatgatttctcatctcaacgcacttgaattagcacatggtgtcaggcagtcccatcacggttcgatctacaaaaagtgcgggatttttttgcccaaaaaaaatgaagtcagcacgttcttaaacagacaaaatcacttgaaaggctgcgtctcttctcccgcattttttgtagaaatacgtagatgaagccagacaccctgataccacgtgaattagccaaacgaagctttgaagaaagaatttaccactgtggggactcgaaccacggtctcccaattgaaaggggtttcatcgaaaatcccactgcgccacgtgcacaatttttttgaaatacgctataaaaaggttaaaaatttttttaaaagcattttcaaattccattttctgaatttgtatttttccaggcggtgacctgaaaacagaacccgatcaggaatccctagccgcagagtggtataacatcaaggatctcaaagccaacaaggttcagttaaggtatctgaaattttttttttcgatcctaaattttgaaaccaatttttttttacagaggccgagatttcatccgactagtcgacgaggccgtcacataccgaacacacggccccgtcgattctattccacgtgtaatgccgttaaatcaaaacgttgctggattatttttggagtttatgattgtcaagcactctagggatgggtaagggtcttagctgcgagggaaaattcactaaaaaaaggtttattcaggctccgaaccgaggtgctcgtgcacaagtcgatcaaggacgagacgtacctgctggaagaggaacagccattcccaacggtggaatttgggttcgagtacttctttgcgatggttgtatccaagtgttatagggtgagcgtgatttgtaaa