Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T26E4.13   

sjj_T26E4.13 RNAi (5)
PCR_productsjj_T26E4.13
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene M01B2.4 Chunk_score Abs_score379
Specificity_index0.324
Rel_score0.479
T26E4.13 Chunk_score Abs_score792
Max_abs_score792T26E4.13
Specificity_index0.676
Rel_score1
Overlaps_pseudogene T26E4.13 Source_evidenceePCR855WS150 Sequence/Annotation Release
Map_statusUnique_ePCRV1580723815808427
WB_DNA_textsjj_T26E4.131190aagctgaacattttaaaacgcaaaaccccaaaagttagtaactagacacaaacaattatggtttgttagttccctaacttttcgaaaaaaattaatgaattctgttttttctgactcggaaagattcttgattacttttctcagcttccactagttacacagttacacaacctgattccccacaagatgctatgggtcttactttccaattatattatatcaattatatttgcaaccactgcttttctcctaaactgtttcttactgttgtcaatattttattacaaaaaataacagttaacccaagcatgacattcatctattggaaatttggagcagatctattttatactttaagcttatcaatttgcattggttattatcttttaatgtcgctttcaactgattttataattaaaaacttaacattttggttggtttgggcatctacatcaattggaagtatgaggtcaattttggcacttttaatatccattaagagagtttttgcaacttttatcccagtttatttccataagtatcggaataaatttccaaatgctctagttctctgcattattttgtcaaagggatttctcgatcaatacatactttttgggttttgtggtaatgatatcgatgcaccattgaaatgtaatggtattttctgtgctgtaaacagttgctataactcgttttatttctcaagcgagctggttgtgtattttgtgaatggagccttttcggctactctatttttttctgatttttcatttggaattatttttggaagatgcaaaaaaactgtgtaatttctagagtgagtttaaaaggttttttaagagaactacactagttcaggtttcaggccactcgcattgcacttctcgactttttcatactattatttttcaatgttctctcttcacattttgttaacaatttaagaattgtcaatataagagaagtcggaccattaacagttgccacgaagatgtttggatttgttattgaaggattgataacgtgcctagtcttatttggtgggaaacgagtgtcttcttttgttgcaacgtcaaattctctgaagctgatctaaacctcaaaactttgtttttcctatataaactttcaaacttttcaaaaaagattagaatgagactcacagcgagacaatttggtaacttttg