Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T26G10.1   

sjj_T26G10.1 RNAi JA:T26G10.1
Simmer:T26G10.1
PF:GL1_8B2
PCR_productsjj_T26G10.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST26G10.1 Source_evidenceePCR863WS150 Sequence/Annotation Release
Overlaps_Gene T26G10.1 Source_evidenceePCR863WS150 Sequence/Annotation Release
Chunk_score Abs_score821
Max_abs_score821T26G10.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII94056279406707
Overlaps_transcriptT26G10.1 Source_evidenceePCR863WS150 Sequence/Annotation Release
WB_DNA_textsjj_T26G10.11081acaattgcactatttccggcatgttcgtttagcagatacacaagatatgtttccttgtacttatttgggacgaagatgtagtgttgtttcagattatcgacagttttgtagcgactagaaacagaaacacgggccgggtctcgcaacgatgctcgttccaactttgaaactttcttggtcattgtggctgagaacaagtaggttcgacgttcacgaggaattactttaagaatcttatccagctccacctcaaaatccatattgagaatacgatcggcttcatccataattaagaatttcaatgctttcaaattgaatcctttggtattctctaaatgatcaaccaggcgtcctggagttgcaacgataatgtgaggtcttcttgcaagagccatcgcttgtgcagccatatccacaccaccgacgataaccgcagcaattaatccaattcctgagcccagagcttcaaattgttggccaatttggaatgcaagttctcttgttggagtcaatactaaacagaagaaagcttgaggatgatcgagaagtgattgtaagacgggaattgcaaatgcgccagtctttcctgatcctgtttctgcgagaccaattacatcttttccttgtagtgcgtgtggaagagcagcttgttgaatttttgacggtttcatccatccgagtcgctgacaagcatcacatagcggctgggagacaccaagttcggcaaatgatttctctttcacatcttcttcatcgtccttttcaatttcttccgtaactactttctctgaagacaattaaccagttatttcagttaaaattgagaatacttacttttagttaggtttttctttcggttcccgagaaacttttgattatcttctccgtcagaagatgaagagtctgacattctgaaataaaaaaaaattatcaatatgtgcaaaaagaattaacggaagcaaagaaaaaacgtttaaaaaaatagaattaaaatataagagtaaaaattcgaactctgcattatgtcgtagtttctgatgtttgtgcaaacacttcgtgtagatttacgagatgcacgcaa