Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T26H10.1   

sjj_T26H10.1RNAiJA:T26H10.1
PCR_productsjj_T26H10.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST26H10.1 Source_evidenceePCR861WS150 Sequence/Annotation Release
Overlaps_Gene T26H10.1 Source_evidenceePCR861WS150 Sequence/Annotation Release
Chunk_score Abs_score756
Max_abs_score756T26H10.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1141950611420608
Overlaps_transcriptT26H10.1 Source_evidenceePCR861WS150 Sequence/Annotation Release
WB_DNA_textsjj_T26H10.11103aggtgttaatggaggaggaagaggagatgatgatggaaccggtggagctgaaggtgaaattgattcatctggaatacatttaaaacatgatatgatataagatactaaagcctacctggttgatgcgctgttggtgataaatgaataagtggatccgtgctcttgtcagaaataagagctaaaccactgttacctcgttgtgttgctcgtcgtgctccactgacccatttattccgaactgattctttaacacttgcaagttgcagtggacgaacttctaccaatggcgtcggcgcatcaaaagcttccatcatgtgctctttctcaacgtgtggaggcaacgatgtgcatgtgaaccatgcaagaactttggcaaatcttaaaatagaaaacaaaacattatgtagcaactcaacaaaaaaaaacttaggaagcattcacgtactttagtgctcttttggacattcgctcgccaagacttcctcgtttttgaatggcaattattacggatgagacaacggttcctagggaaatcactattatcattgctagaatgaaccatccaattagaggaataaatgtagatgttgtaggcatttgatcggagaccattaacatcaaaatggacatggaaagaagggtcgtgatacccaatgatactttctcttcacgcattcctgatgcagatgatgttctgaaaatatgaaaacatggctctttaaataattaattttttgaaatttgttaaaacttacgtgaagaatcctacaatagcaattagagtaataatcgatgttggaataataagattgactaaatagaacaacggttttctccgaagatatagcgtcaactgcagtaacgtgtagttatttggacaacatgcgtatttcacttcctgtcttttaactgaaaacgaagaaaaatattttgaaaacctcattaatgatttagtcatttaaatgctcactttttgtttgtaaaatgtaccatccttcgttttccaagtagtttgatgttccaattttatccgagtatgggaaataatctatacctttttggtcatatgtccaagatgagaaggtcattgtgcagacctaaaa