Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T27F7.3   

sjj_T27F7.3 RNAi JA:T27F7.3
Simmer:T27F7.3
PCR_productsjj_T27F7.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST27F7.3a Source_evidenceePCR1161WS150 Sequence/Annotation Release
Overlaps_Gene T27F7.3 Source_evidenceePCR1378WS150 Sequence/Annotation Release
Chunk_score Abs_score1294
Max_abs_score1294T27F7.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII49919034993678
Overlaps_transcript T27F7.3b.2 Source_evidenceePCR212WS150 Sequence/Annotation Release
T27F7.3b.1 Source_evidenceePCR214WS150 Sequence/Annotation Release
T27F7.3a Source_evidenceePCR1378WS150 Sequence/Annotation Release
WB_DNA_textsjj_T27F7.31776agagtagcatggcattagagcagcaactgacagttttccatgatgacctctccattcttccattattcttcgaggagcagtaaatggtccaacttgatgatatcgagatgtgaatagtgcgattcctatgtttattgcgatcataacagccatagcacttcctcgccacttcttcaaattttgaaatgctcctcctgcataaatacaaagtagtggaatgattgggaggaggaaacgttgctctttgtgcggaagcaaagagtgaacaatgatgtaggtgatcgtagcaaaaaatggaagcagcgacggtcggaatatgtttgggccgagaagtccgacgatgatgggaatcatttgaacagtgagcactgcaggtattccagaaacgatataccagtaccatggatgaactccaaacaaagcacttcctccttgcacgacattgaactgtagaaaattccaaagtggtatcgttggtgttccataagcccatgaatcgatgagagttgtcacaatcagaatgggtagtgtcacagggagaacaagttgaaaaatcaatcgaacaggagtggggctgtgatacaaatgatatacaccaaaaacaagccaaattaaagctacagtgggccttataataatagtaagaactcctaaagcaatataaggccacgttggacctttaaagtttttagtttcaaaaggaaaccaatttaaagcaattaaagtaagagaagtttcaagagaattggatagggtacggggtgcacaataaaatacaaaccacgaacttaaatatgtgacaaaagagttctcagctattcctttagtcttacataaacgtaggcaaattttgtagaatgaaaagtcagctaaagcaaaaagaagggcatgagcaagtctaggaatatgataaataaggggttgagaactcaaagagagaatatctagaaatttaataataacagcaatcaaagcagggtggaagaatgaacgtagcgagtggcgccactcccacgaaaggtgaccagtgccatagacgagatggtgagcaacttcagcagactggtaaacttcgtcgggaacgaaccacgaagcaacaaggtagacagaaatacaacgaaaaacgaccaatttggccaacaaacgaagtgtagtgcgcattctcactgaaaagtgaaaaggtacaaaacgagatttggtagccactgatttgctgcttccagatttccttcagtgagaatgcgcctgtaccggataacgatttacatggaaacactacaaacgaaaacaggaaaagtcgaaggagaacagcaaaacaaggcaattttttcagacaattattagttaaaaacataccttcttcaagtattgaacaattcttttgagatcgtattccgtgccaattcctgtaattagatcatatattttaaatgtttcattcgtactatttaccttgaacagtagtgatagtctttcttcctgtacgctgttgaatgcggatgtggcaaactccttgtctgacaccgtcttcggtctcaagttgttcaaaggcgtctgaaagtatgaaaaaaattatttgagaattgttcaataattttaaatacccgctggtctgttgagatttgcgatggacatatatcagtggtaggcttgactctatttacctgaaaaagtttgaatgacgtttgtttgcatagaaaaaagaggaaagtgataagaacgcttgtaaaaaatgtgatgtgaatcatcagtatatcaggattgcacgagaaaaat