Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T28B8.2   

sjj_T28B8.2RNAiJA:T28B8.2
PCR_productsjj_T28B8.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST28B8.2 Source_evidenceePCR209WS150 Sequence/Annotation Release
Overlaps_Gene T28B8.2 Source_evidenceePCR275WS150 Sequence/Annotation Release
Chunk_score Abs_score233
Max_abs_score233T28B8.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI81485748149644
Overlaps_transcriptT28B8.2 Source_evidenceePCR275WS150 Sequence/Annotation Release
WB_DNA_textsjj_T28B8.21071gaagaaacattgctttcaaatggagcactattaggagagatgtgaaaatgaaatttaaatgaagttttaaattatcatacttccctcatcaatacttgcatttcaatattaaactttggcaactcatatcttgattgaccaaaaaagtgggcaaatgtttataattaaaaataagtaaaaaacattggaagattaaaaactttagaaactttttgagaaaaaaaaactgaaaaatgtcacaagaaaaagtgcttcctgtcctcggaaaaaactgataaatgattcaaaaagtgtttcaaacaatggtaaccatggataattgagcatcttctttcagacggacgcatgaaaatgtgcccaccaggtggttcaacattcacaatggcatggtcaatgtcgtgttcgatgcgcaggagaaaacgagatgttggacgatatttcggtaatttttttgggtagagaactagaacattagagaacattagaaacctttggccgaatatgtgagaaccagcaaaatttagaaagaattttctaatatttccttcgaatcaaagtgggagacaattattttgcagttgcaatatctctaaaatcaagtgttaaaaaatacataaacctgtctccctcctgtctgacaaagaattttgtttgttaattgaaaaatgtttaaaagacgtacaaaaattgcctgaaagttgtcaattgaaaaaaccttcacggacctcttcgaccactcgcaatttccatgtaatttttaacagatcaacacaaaatatttaaatattttagagttacacaaattttaatttttatataataactttgggtcaagataccacaaaaaatccttttgtatagtttccaacattattaatttccaaaatctttttttttgcagaaaaacgtgctctgatcgccccatcaatccgtcaacttcaaacaatttgctgtcaagttggttgcaacgtggaagatcttcttgcctactgtgccccaatttaagtaccgcccacaaaatacgcatcagttttttcccgctctccgtcgaatgaatatcacatccctgtt