Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T28C6.6   

sjj_T28C6.6 RNAi JA:T28C6.6
[cgc5655]:T28C6.6
Simmer:T28C6.6:Repeat_a
Simmer:T28C6.6:Screen
PCR_productsjj_T28C6.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST28C6.6 Source_evidenceePCR900WS150 Sequence/Annotation Release
Overlaps_Gene T28C6.6 Source_evidenceePCR924WS150 Sequence/Annotation Release
Chunk_score Abs_score861
Specificity_index0.229
Rel_score0.987
Map_statusUnique_ePCRIV88245718825966
T15B7.3 Chunk_score Abs_score360
Specificity_index0.096
Rel_score0.413
T28C6.4 Chunk_score Abs_score872
Max_abs_score872T28C6.4
Specificity_index0.232
Rel_score1
B0222.8 Chunk_score Abs_score240
Specificity_index0.064
W05B2.6 Chunk_score Abs_score124
Specificity_index0.033
Rel_score0.142
W05B2.5 Chunk_score Abs_score106
Specificity_index0.028
Rel_score0.122
Y2H9A.3 Chunk_score Abs_score68
Specificity_index0.018
Rel_score0.078
W05B2.1 Chunk_score Abs_score129
Specificity_index0.034
Rel_score0.148
B0222.6 Chunk_score Abs_score240
Specificity_index0.064
Rel_score0.275
F55C10.2 Chunk_score Abs_score62
Specificity_index0.017
Rel_score0.071
F11G11.10 Chunk_score Abs_score175
Specificity_index0.047
Rel_score0.201
C29F4.1 Chunk_score Abs_score518
Specificity_index0.138
Rel_score0.594
Overlaps_transcriptT28C6.6 Source_evidenceePCR924WS150 Sequence/Annotation Release
WB_DNA_textsjj_T28C6.61396acgttttacgtttacaccaccactgtcgcgccaccatcacaatcgaccttgccaatcaattttttcattattctcttcctcctttttgcttcgttttttctatcctttcatctaacacagacacaaacacaaggttgtaaacctgtagaaatggccgccccttctgtaaagggtagaaaaatgtataaaagggtagtggtaggttgagaatcttcagtttccaacatggatctcgaacaacgtattaaagcttaccgcttcgtcgcctactcggccgtcgccttctccgtcgtcgccgttatctcggttagttctataattctagatatctgtaaaaactataagctgattggtaaacaaacgaacactaattcgattattgtgttctagttactgaaccgtaactaggtagcaatgattcccatatacattcactgaaactgtaaaattttttaaaaacctttttagttgtgagaacgattcgccatttctagatataacgtgttctctcttaaaactcttaaaaccaaattatttaaaacattatctaaatacaatttttcaggtgtgcgtcactcttccaatggtgtacaactatgtccaccatgtgaagagaaccatgcactccgagatcaatttctgcaagggatccgccaaggatatctggtccgaggtcaaccaccttaaggccatcccatctggaaaccgtaccgcccgtcaagctggatatgatgctggagtcaccggaggatctgcctctgctggaggttgcgacgcttgctgccttccaggagccgctggaccagctggaaccccaggaaagccaggacgcccaggaaagccaggagcaccaggacttccaggaaacccaggacgcccaccacagcaaccatgtgagccaattaccccaccaccatgcaagccatgcccagccggaccagctggagccccaggaccagcaggaccagccggagatgccggagccaacggaaacccaggagccccaggaaacgacggacaaccaggagccccaggaaacaagggaccatctggaccaaacggaaacccaggagccccaggagccccaggacagccaggacaagacgctccatccgagccaattacaccaggagcaccaggaccagctggaccagccggaccacaaggaccaccaggagccccaggacagccaggacacgatggacaaccaggagccccaggaccaaagggaccaaatggaaacccaggagccccaggagccgacggaaacccaggagccccaggacaagctggaacttccggaggtgccggagagaagggaatctgtccaaagtactgcgccatcgacggaggagtcttcttcgaggacggaactcgccgttaaattttatgagaa