Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T28C6.6   

sjj_T28C6.6 RNAi (4)
PCR_productsjj_T28C6.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST28C6.6 Source_evidenceePCR900WS150 Sequence/Annotation Release
Overlaps_Gene (12)
Overlaps_transcriptT28C6.6 Source_evidenceePCR924WS150 Sequence/Annotation Release
WB_DNA_textsjj_T28C6.61396acgttttacgtttacaccaccactgtcgcgccaccatcacaatcgaccttgccaatcaattttttcattattctcttcctcctttttgcttcgttttttctatcctttcatctaacacagacacaaacacaaggttgtaaacctgtagaaatggccgccccttctgtaaagggtagaaaaatgtataaaagggtagtggtaggttgagaatcttcagtttccaacatggatctcgaacaacgtattaaagcttaccgcttcgtcgcctactcggccgtcgccttctccgtcgtcgccgttatctcggttagttctataattctagatatctgtaaaaactataagctgattggtaaacaaacgaacactaattcgattattgtgttctagttactgaaccgtaactaggtagcaatgattcccatatacattcactgaaactgtaaaattttttaaaaacctttttagttgtgagaacgattcgccatttctagatataacgtgttctctcttaaaactcttaaaaccaaattatttaaaacattatctaaatacaatttttcaggtgtgcgtcactcttccaatggtgtacaactatgtccaccatgtgaagagaaccatgcactccgagatcaatttctgcaagggatccgccaaggatatctggtccgaggtcaaccaccttaaggccatcccatctggaaaccgtaccgcccgtcaagctggatatgatgctggagtcaccggaggatctgcctctgctggaggttgcgacgcttgctgccttccaggagccgctggaccagctggaaccccaggaaagccaggacgcccaggaaagccaggagcaccaggacttccaggaaacccaggacgcccaccacagcaaccatgtgagccaattaccccaccaccatgcaagccatgcccagccggaccagctggagccccaggaccagcaggaccagccggagatgccggagccaacggaaacccaggagccccaggaaacgacggacaaccaggagccccaggaaacaagggaccatctggaccaaacggaaacccaggagccccaggagccccaggacagccaggacaagacgctccatccgagccaattacaccaggagcaccaggaccagctggaccagccggaccacaaggaccaccaggagccccaggacagccaggacacgatggacaaccaggagccccaggaccaaagggaccaaatggaaacccaggagccccaggagccgacggaaacccaggagccccaggacaagctggaacttccggaggtgccggagagaagggaatctgtccaaagtactgcgccatcgacggaggagtcttcttcgaggacggaactcgccgttaaattttatgagaa