Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T28F2.5   

sjj_T28F2.5 RNAi (12)
PCR_productsjj_T28F2.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST28F2.5 Source_evidenceePCR866WS150 Sequence/Annotation Release
Overlaps_Gene T28F2.5 Source_evidenceePCR866WS150 Sequence/Annotation Release
Chunk_score Abs_score784
Max_abs_score784T28F2.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI36418203643495
Overlaps_transcriptT28F2.5 Source_evidenceePCR866WS150 Sequence/Annotation Release
WB_DNA_textsjj_T28F2.51676aactcggagcaattcgaagaagatgccatttgttgcgaagaaagagagaaagagatagatagagatattgaaaatgatcaagaaaggaattcgaatcagtgattgttcacaagaaaacatacaattgaatatacaggcacctagtacctgtacgtacctctttcatattgatgtgacatatccatatcgtcgtattcatcaaatccatgccgatcatatgatgtttgtcgttgaggtgctggtggtggagctgattgcattggttgttgctgttgtggttgctgctgcattccaccgtaggaaccagttgcctgttgtacacttatacttggcattcctggacgaccactttgcattgggggtgccaagtacggaggattcatggatcccattggtccacccatttgtgacattgaggctatggattgttgaggttggagttgcggtggcagttgaccggcgtttccttggaaaccctggaaaaagtttggttttgaggggtaaattgacagttttgtttctaaaatctcagtgttacgtctctcgaatctagcggcgataggcaaccacaattaggcacgtagcgtcactaaaaatggtatcagcttggagcaacgatgggtcccgcagcgaacggtagcgtaacacagtgatgggtctcaaaacgatgggtctcgtcacgaatggggctaacagttatggttctcctgaaaagggtctcaaagctatcagtctcattattatgggtctcacagcgatgggtctcgtagcgatagatctcacagttaaggatcttaaagttattgctctcccagtaatgtgcgtacccccaagcacagtttcgcagcgacgtgcttcaaagagggtcttactgtgttgggtctcgctactacacgtaagttttacaagaacgggtcttgtcacgatctcatgtacctttcatagaaacgatcatattttgggtctcccacccacatttcacacaccaaatcagaaaaattaggtaggaaccctaaatttcaatttccaaacaaaaccaacctgcatcatctgcgccggcgtgaacaacgtgctcggtcctcggttttccattggatttctttttattctaggcggtgacctgactggcggatgtgtggctctccagtaggcttccataaaatctgcaagatgctcacacgcatcttccagttgattctcgtcgagcagaacgtcgaagagctctgcttggcactgggccagcttttctgcggccaccatttgcacgttcatattccgggattgcgattttccacgcgatttgatgagtcgttgaagaacctggaaataaaaaacatatttaaaatcttactctcagaaaaagaaactcacttttggactagaaattttgatataaacatgaattggagcaagacttgtctttgctaattgagatggatgattgatagtgtcacaatcaagtaccaccagttgcatcgaacgagccagctcgaaaattctttcgatttcagtttgaatttccgccaaactgttgctagttctcgagtttgccctttccatcattgctcgcttattcggattgttgagaagacttcgctttgccaatgagatgtctgcagtaactcgggtgatgattattctggaaaaaatgttggagaaactgcagaaaagccagg