Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T28F2.7   

sjj_T28F2.7RNAiJA:T28F2.7
PCR_productsjj_T28F2.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST28F2.7 Source_evidenceePCR783WS150 Sequence/Annotation Release
Overlaps_Gene T28F2.7 Source_evidenceePCR783WS150 Sequence/Annotation Release
Chunk_score Abs_score720
Max_abs_score720T28F2.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI36556873656827
Overlaps_transcriptT28F2.7 Source_evidenceePCR783WS150 Sequence/Annotation Release
WB_DNA_textsjj_T28F2.71141gaaacattgatgcagcccttccacgtgttatttgatccttgatatctttcagatcaaacggcaaaattgttggctgtttgtagtctttgtgctccttgagcgcagagttttgtcttgtaactgatgctagtctccgctcgatgtctggctcgttttcccatgcgagtttacaaacgttcaactgttccgatgttactctgtgcattgataatcctttaatcttttctctgaaattcgtaaaaacattattttatcctaatttaactagctatcccacctcaaatgactcatatcttttccagattttcgatgcctaaacaacttgaatccagtgacaacatcttccagctctttctcatgcatttcctcatttttcttcttcgaatacatataatctcttcgctttctcgaaaatccgatccatccgatctttgataaaaataggaagagttcgataatagtaaacacggacattcccatgaacattcccatattaccaccgatatcggagagcagttcggtgagtgacattccacgcttttgaatgtattctgtgtaggacatgtcacggaagaagacgttcacaacttggaagtttaatctgaaattcgaaaaagttggtgagcaaattagtagaaagactgatattctgtttctgtggattcaacatttgattccatgaatatttttccttttaaaatgctcacttcatatgcggaatcgtccaagtctcttgctttccttgcttcgtcaaccacatcagtgcacctctagacaatccttttccatatgaattaaatgaatgatacacttgacttttacactcaactttacattcttcacaagttggcatctcaatgttaaagctctgattcactactttcttcatcttggtgtccatgcagatgaatgtctcgtagggagtacagtcgttgaatcctgaaatgaaaattatttaggtgtcgggtttttgtgatgccttaaaaattgtgcatatgtatgccaaacacattagcaatttgtttaatttttccaattttccattaaagccgattaatacaaaattccctttttttcttaccattgtgactgttttttttttcaaaaaattatatagaaatatagaaaaaccagccgctga