Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T28F3.2   

sjj_T28F3.2RNAiSimmer:T28F3.2
PCR_productsjj_T28F3.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F26D10.3 (3)
Overlaps_transcript F26D10.3.1 Source_evidenceePCR910WS150 Sequence/Annotation Release
F26D10.3.2 Source_evidenceePCR832WS150 Sequence/Annotation Release
F26D10.3.3 Source_evidenceePCR760WS150 Sequence/Annotation Release
WB_DNA_textsjj_T28F3.2981tgtccaggatcttcttcttcttgacgttgccccactttcccttggtattgagaccgctggaggagtcatgactgctctcatcaagagaaacaccaccatcccaaccaagaccgctcagaccttcacaacctattctgataaccaaccaggagtgttgatccaggtttacgaaggagaacgtgccatgaccaaggacaacaacttgctcggaaagttcgagctctccggaatcccaccagcaccacgcggagtcccacaaatcgaagtcactttcgatattgacgccaacggaatcttgaacgtctctgccactgacaagtccaccggaaagcaaaacaagatcaccatcaccaacgacaagggacgtctttccaaggatgacattgaacgcatggtcaacgaagctgagaaatacaaggctgacgatgaggcccaaaaggaccgtattggagccaagaacggactcgagtcatacgccttcaaccttaagcagaccattgaggacgagaaggttagttaattaatttatattttgtcaacaagtttttaatttcatttttttcagctcaaggataagatcagcccagaagacaagaagaagatcgaggacaagtgcgacgagatcttgaagtggctcgacagcaaccagaccgcagagaaggaggagttcgagcaccaacagaaggatttggaaggattggccaacccaatcatttccaagctttaccagagtgccggaggagccccaccaggtgctgctccaggaggagccgccggaggagctggaggaccaacgatcgaggaggtcgactaattatttatcttcttttttgatctcggtttttatctttattctcttttcccccaaatcccctatataatcgatcttctgcccccttccctgtcacccacccaaaccgttattcgcctagaatggtgaacaataaaaaaattaaaataatccaagttgtttgctttcgt