Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T28F3.2   

sjj_T28F3.2RNAiSimmer:T28F3.2
PCR_productsjj_T28F3.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F26D10.3 Source_evidenceePCR910WS150 Sequence/Annotation Release
Chunk_score Abs_score868
Max_abs_score868F26D10.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1728032717281307
Overlaps_transcript (3)
WB_DNA_textsjj_T28F3.2981tgtccaggatcttcttcttcttgacgttgccccactttcccttggtattgagaccgctggaggagtcatgactgctctcatcaagagaaacaccaccatcccaaccaagaccgctcagaccttcacaacctattctgataaccaaccaggagtgttgatccaggtttacgaaggagaacgtgccatgaccaaggacaacaacttgctcggaaagttcgagctctccggaatcccaccagcaccacgcggagtcccacaaatcgaagtcactttcgatattgacgccaacggaatcttgaacgtctctgccactgacaagtccaccggaaagcaaaacaagatcaccatcaccaacgacaagggacgtctttccaaggatgacattgaacgcatggtcaacgaagctgagaaatacaaggctgacgatgaggcccaaaaggaccgtattggagccaagaacggactcgagtcatacgccttcaaccttaagcagaccattgaggacgagaaggttagttaattaatttatattttgtcaacaagtttttaatttcatttttttcagctcaaggataagatcagcccagaagacaagaagaagatcgaggacaagtgcgacgagatcttgaagtggctcgacagcaaccagaccgcagagaaggaggagttcgagcaccaacagaaggatttggaaggattggccaacccaatcatttccaagctttaccagagtgccggaggagccccaccaggtgctgctccaggaggagccgccggaggagctggaggaccaacgatcgaggaggtcgactaattatttatcttcttttttgatctcggtttttatctttattctcttttcccccaaatcccctatataatcgatcttctgcccccttccctgtcacccacccaaaccgttattcgcctagaatggtgaacaataaaaaaattaaaataatccaagttgtttgctttcgt