Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T28F4.1   

sjj_T28F4.1RNAiJA:T28F4.1
PCR_productsjj_T28F4.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T28F4.1 Source_evidenceePCR835WS150 Sequence/Annotation Release
Chunk_score Abs_score772
Max_abs_score772T28F4.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI74730827474271
Overlaps_transcript T28F4.1.2 Source_evidenceePCR833WS150 Sequence/Annotation Release
T28F4.1.1 Source_evidenceePCR835WS150 Sequence/Annotation Release
T28F4.1.3 Source_evidenceePCR833WS150 Sequence/Annotation Release
WB_DNA_textsjj_T28F4.11190gaagtcgtcaaaaagctccgtactgcgacgtttgttcttgtttgcgtggctttcaccggttgccacgtccaaatcggtcagctcgtgagtatcttcgtggctcagtggctcggggataatgtccgtctgaaattcggcttttgggatatttatgcttcaaagttttcacaattcatttgtgtgtgtgtgtgtttatacaattgaacttatatttttcaataacagtggattgaataaaaaatgtctgtagatattttacgctaattggctctttgggaatatagcaaactaactaatactatatatatagttaaaactaaaacaataagtcttaacccgatagcttttaaacttacaaagattggctccggtccaacatttgacagaaagtagtcatctcctgggaaaaacgaggactgtacacttgtcgttggagatgagaagtgatcgaaagacgatgactcaacagctggaagcattccagacatactggctaatggatcagacggcaatggcatatctccttcggttgcggattcagacatcgagctgccgtacatatcaaatggttgataaccaacagagcttggtgcagagtaggaagaaggcatatcgtaactaccgtaagatgtcattccagctgatgccatggacatacttgaactcattccaccgaatccacccatgtctgttccagtgtatggttgatgaagccacagatcattttgatgcatggaagcatgttcatagtgggtaagatcttccagtctgaactcatcgacttcttcatcataaaatgaaacatctgacatatcgtactcttcgtattcttcatcagatgaggccatgtcctgttccctacttgatgaggttttctttggcattttgaaaagatccgatacaaagttctttatcagaactctaaaaaatggaataagttaaagttagttttttgttgaaatcacacacaaacctttttctcattgctctacctccacatccggctctcttcttttcagatttatcactgcatttgtgaagagccacgttgcagaggtgcccgaaaatttcctctgttaaatcattcagcttgtacgtcatattcatggtgggttctgaaaaaatattagttcaagtatagtttagatataaagttaaaattgaagaggaaaagcaaattggaaggagca