Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T28F4.2   

sjj_T28F4.2RNAiJA:T28F4.2
PCR_productsjj_T28F4.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST28F4.2 Source_evidenceePCR888WS150 Sequence/Annotation Release
Overlaps_Gene T28F4.2 Source_evidenceePCR888WS150 Sequence/Annotation Release
Chunk_score Abs_score742
Max_abs_score742T28F4.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI74801157481801
Overlaps_transcriptT28F4.2 Source_evidenceePCR888WS150 Sequence/Annotation Release
WB_DNA_textsjj_T28F4.21687atttacttgcccaagatgcgcggtggcggttttgtgcagatttttaaggatttttccaattggtctactgtagcagttgtaccacacgtggcaaatgcaaataataaggtaggtcaataaacaagaattgcaagagatagagaattagacagtcaagaagcattgtgaaatgacgtcattcccctttcggaatgatgtcataaaaatagaaaagataagaatgtgtcaagaatatggatatttttagattggggcatgtaaatttgaatccataaataccacatttttaatgagaaaaacaaagaatagattgggaataaataaaatcttgcaatagtttcagatttctcgtattttctggattgccatatttttatttgttctgggaatgttcgcatatgaactttacattttaatcgcaaagttcttttcgtatcctgccactgtcaacacagaaattcttttcgagaaacaggtatctttttggttatataaaactacgaggattttattttgatctggaaattgtaaaagtttgttacgttattactggcaaattggaactgaatatgaatttagaaaataagtctacaagcaagtttatccagatatttcccgtcgttaccgtgtgcaacatgaatccttacaaatacagtgttgtaaaatcgaacagtgcattttcaagtgttaatactctgatgacaacatattctgatgctactgttggaacattttcaactgataaatggggtctctatgttagtttgtgaaacaatctcgcatttagagtagctcatctattttaggctgataacgatgaaacctacgatttggattctcgagcagcagatgctcttgtattggaagcaaatttgataagtgatacggcaaaagttcctgctttatacacttacgcggatttgattcaagattgtagttttgcgggtattccttgctcggagtaagttgaaaatatatttcgatttgggttaggtcacatagtttttggttcaaaaaactcaaacattgtaactgacaggcaataaactaattcttaaaatacaaaaaataattttagatcagatttcacaaagttcattgatccagtgtatggagcatgctactcatttaacgaagatgcgtcactcaattattctgttagtagagaaggtattcaatttggattaaaattgatgcttacggtcacggtaagtacttttttaacaacttttgagcatttcaatacatcttagcaaacaaaaacaaatgggaataccgattcgttgccaacaactaaactagcgggtgcccggattggagtaaactcacgtgggagtagtccaggactagattcaaatggaatcgatgcaggagttggatatgaaagtgctgtttctgttagcttggtgagattatagatagctttcaaaattcatacgtacacctttagactcaaaacgttcgagcaaagaaaccatatggaacatgtgtggatcgagaaccggatagctcggattattacaaggtttggattattttctagtaatttctacacaaaataaaataagaaagaaatcttcactgaattttgattacaacgagtttgtatttatttatttgttagtatcggatttttcataacttcagtcgcttaaaaatggaaaattgccaggaagggttttgtgta