Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T28F4.6   

sjj_T28F4.6RNAiJA:T28F4.6
PCR_productsjj_T28F4.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST28F4.6 Source_evidenceePCR409WS150 Sequence/Annotation Release
Overlaps_Gene T28F4.6 Source_evidenceePCR412WS150 Sequence/Annotation Release
Chunk_score Abs_score351
Max_abs_score351T28F4.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI74933387494316
Overlaps_transcriptT28F4.6 Source_evidenceePCR412WS150 Sequence/Annotation Release
WB_DNA_textsjj_T28F4.6979tgtcaaattttgtgatttttcccagaaaatacgatacccggtctcaaaacgatcgattgttgttaattgcaaaatggtgtgcgcctttaaggaatactgtaattttgaacttcttgttgtttcggaattttttatcgatttttcataaatagtttttttaaaataaaattatttatggaaagactaaaataaaacaattgaaaacacacttagacagaatgagataaaaactatgaaaatttaatgaaaattccattgcaacgaaagattaaagctacagtaatctttgaaggcgctcgcccgcttctaatttaaaaaattgctgtgtcgagatcggaattttgttggcggaaaaatagaaagtttgatttgtaacatttttaggagaaacaataatattaccagcttgatcgagaaaacttcgttgagcttttttaatctgcattcctgtcgaagtcgtcttgtccatgcaacaacaattagccaatatacttataacggatttatgaagatcctcgtggtacctgaataaatgatatgttttgttccagatctttacggtttccttgatataactaacatagaagtgcccaataagctagtttctctagaaaagaccgaaactaaatcctctagattctttttatgtgatacaaaacttccaatttttgtttcatttggaagcattgccttcaacttttttgcagatttcagtgccacatctttatcttctacttttatttttgcaatgacattctcaaattcatttcttgtatcggcagctttggatctcttgttctgaattgattcgtcgttcgcaacacttctcctctttttcggtggaatcgcacctccatttgcgctcattgcctgtaacaattggaccattatgcatcccttttgtcttttctacacgcacacatgcacaccgtctattctctttcgtttgattcggtcgatatttgttgtgaagggagag