Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T28H10.3   

sjj_T28H10.3RNAiJA:T28H10.3
PCR_productsjj_T28H10.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST28H10.3 Source_evidenceePCR830WS150 Sequence/Annotation Release
Overlaps_Gene T28H10.3 Source_evidenceePCR830WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRV1251603212517046
Overlaps_transcriptT28H10.3 Source_evidenceePCR830WS150 Sequence/Annotation Release
WB_DNA_textsjj_T28H10.31015cgtccacatggaaaagacctctacaaaggtctgaaaattgattacaaaggtgcttcagtgacaccggaaaactttttgaatgttcttaaaggaaatgccagcggaattgatggtggaaacggaagagttcttgaaacgtgaggtttctagcaattgtgtcaacttgttttttattttcagaaacgacaatgatcgcgtttttgtttacttcactgatcacggtgcggttggaatgatttcattcccagatggcattttgactgtaaagcaactgaatgatgttcttgtttggatgcacaagaataagaagtactcacagttgactttttatcttgaagcctgtgaatctggaagcatgtttgaagaggtactccgatcggatatggatagtaagtttcagagaattctccaatattatagtattatcgaattatagtttatgcaatttctgctgcaaatagccatgaaagttcatggggaacattctgtgagaacgacatgaatcttccgtgccttggagatctttttagtgttaactggatgactgatagtgacggagaagatttgaagacagaaactcttgaattccaatacgagctagttaaaaaagagacaaacctttcccatgtgatgcagtttggtgataaggatattgcgaaagaggcagtagccttgttccaaggagataaggaagatagagagtatgtcgaagattttgtaagtatctatgtgaaaattgatattttgtcatgaaaaggtcattttgtttcagggattgtctgcttcaaaatctgtcaactggccagcaagagatattgagctcaatcacttgatttcgcaacacagaaagtcgaatgatttgttatcgtcgaacaagttagagtacaaaatcaatagaatcaaggagacacgaagagcaatcaagagaaatgtacatatgattgttcagaagttctttgatggagagtctgaagagtaagttgaagaaaaatcgagctgacatggggatgttctt