Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_VF36H2L.1   

sjj_VF36H2L.1RNAiJA:VF36H2L.1
PCR_productsjj_VF36H2L.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSVF36H2L.1 Source_evidenceePCR748WS150 Sequence/Annotation Release
Overlaps_Gene VF36H2L.1 Source_evidenceePCR748WS150 Sequence/Annotation Release
Chunk_score Abs_score685
Max_abs_score685VF36H2L.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI92322669233354
Overlaps_transcriptVF36H2L.1 Source_evidenceePCR748WS150 Sequence/Annotation Release
WB_DNA_textsjj_VF36H2L.11089ttcagtcattggctcgtcaggtactgattgcctctgtgtcctcaattttcgttcttcaattaatgttcgcacttgttttaaagtgactgcatccgttattgattgtccaattccattgacaaatgatgatattgttccacccattatgacattgcaataagcaatacaaatgagaagaatcaggaattgaacggcaaagacgagtacatggaagccacgagagttgagagaactctgaaatatttttgatttcgataaaatacatacttttagttgtgataataataataatatttttaaaagtaaaatattctcaccaagaatgtcaccaacaaatgtgaaacaaccgcggcagctccaggcacaaaagctgaaggtatccttccaattttatggcacgagtcccaaaccataatagtccatgtaacatgaaatagagttaataagattgcagaaagggtgtaacataggggaaggtatttcccagcacgatttgtgtcaatttctccagttttaagagcatttggaagtccgatggttccgggtcccgagaagattgcaaatgcgttcattgtgtagaaaagtgctgagattacacccattccgagaccacagacaagtgcaagcatgtgacgagcattatgaagatcgctgactcctggagcaactgagatttgtccttgacgggtgattttattgagtcctctgaaaataattgttacattagttcataataattatttagaattttttcgtttctcagaaaatttcattggggtttttttcggtcctaaaaaagcaaattacaaaagagaaaaccgaagaaatagtcccaaaaaatagttttaaaaaagttcttgttgaaacatgttttatttttcaaaaaaaaatgctgttactccagaaaaatattgtcgtttgaaattttatattaaacttttcaaaaaaaaaagaagaacaaacctttgagctttcttcaataacataaaatatgcaactcttgatagttcttgtgcaataatacacacagtcaatgacaataagaacgtgtctggaagtacagttgaaagaccaagccatgcaagagat