Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_VW02B12L.1   

sjj_VW02B12L.1 RNAi JA:VW02B12L.1
Simmer:VW02B12L.1
PCR_productsjj_VW02B12L.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene VW02B12L.1 Source_evidenceePCR1093WS150 Sequence/Annotation Release
Chunk_score Abs_score1051
Max_abs_score1051VW02B12L.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1143636011437499
Overlaps_transcript VW02B12L.1.1 Source_evidenceePCR1093WS150 Sequence/Annotation Release
VW02B12L.1.2 Source_evidenceePCR1093WS150 Sequence/Annotation Release
WB_DNA_textsjj_VW02B12L.11140gcaatctctggtgggaatgtcagcgagagatcggtattagaatcagctccttgagcatccatgtttgcgagaagtgtttgattgtatggatttacccagcttgaaccaaatatgttgacagactttgagtagaaatcgttgtaaatgaatcctgtgtaaatggcaaacattcccataagcaagacaacatatcgacctccaaagaaagtgttgaaaatctcatccttgatcttcatggagatgagcttcttctcaaaaataacaaacgcagaagcagcgataagcatgataattccatgtccagcgtctccgaacatgacagcgaaaaggaatgggaaagagataatggtccatggagctggattaacttctcgatagttggcaataccgtatgcatcgacaatattttggaatccttgggtgaacttgttcagtttgaaataagttggtgggtacttatcggtttccatttcgttgagaattgccggaactgtggagccagagtggatggttcccatgtgaagtgagttcttcacttgaccgatgtcggcttctgggacccaacactcagcgatcaaacatttttgagtaacatcaacggagaacatgttgagagtgtggaagatggatttcagcttcagaagcattattccccattttctcaagttagttgcagctgcatggatgcattttgatcgataatccaatgtcttctcaataacggccttcatgtcagttgtctgaactttgatgttcagaagcaacttggttctttccgctggattctctggaactgtgtagcactttgcctggaatccatcgcagatcttcttgaccttggcacgaagttgctctcctgagaagaaaagaatgaagacacatttgtcctcgaactcgttcgagaagagttcggtttgctcttgaatttgaatgaattttgcgaaaaccttggcgcgtgacagtctccaaaggaaacgctcgaatgcgatggccttggaacgcttgacaactccggttacaaatctggaaatagactgaaataagagagatcctaattttttaaaactgacttcaactccttctcatccttcactggcttgtcaaactcatccttcatcccaaaactaattgggccagcct