Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_VW02B12L.4_b   

sjj_VW02B12L.4_bSequenceCAATCCAGCATTACTCGAAAAAG
Length23
In_sequenceSUPERLINK_CB_II
PCR_productsjj_VW02B12L.4