Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W01A8.4   

sjj_W01A8.4 RNAi JA:W01A8.4
Simmer:W01A8.4:Screen_A
Simmer:W01A8.4:Screen_B
PCR_productsjj_W01A8.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW01A8.4 Source_evidenceePCR441WS150 Sequence/Annotation Release
Overlaps_Gene W01A8.4 Source_evidenceePCR541WS150 Sequence/Annotation Release
Chunk_score Abs_score478
Max_abs_score478W01A8.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI70681357069096
Overlaps_transcriptW01A8.4 Source_evidenceePCR541WS150 Sequence/Annotation Release
WB_DNA_textsjj_W01A8.4962acgaggataacgacacagctaaaaaaaaacaaaaatcgagaaaaagttgcttacattcggatctaaaagtaaatttaagaaaacagatagatcgagacgattagaagtcgattccgatggttggagcaaagagaccggatcctccggtttgtagagttcttccttgttgacgatcccaccaaagaagctttccatccaaacatgcttcattcgacttgtccattgggacaaacataagacgagtgtaaatgtagaagagagcgaaaacggttccgacgtacaggaatacggtgcgtggtgtgaaacggaagaactcggcttgagtcatatcagcagaataccaacggaacattgctggatccatggtgactccctccttgtacttgaagctatgaggatcgtattcacgacggagatattccttcttcaaaatctccttgacacgatatctgaaagtaattttttaaaaataaaatgtagtttttttatcataaagttggatattaaaaactgaatttatgttaattcagtgtttaatatccaattttatcgcaacagtttttttaaagcaatttttgatttgatactctgtaaattatatcaagaaactgtttttttttgtctctattgctaataaatcacttgaaataagtgttcatcaacgcaaatgttatcatatattgatttttcaatagaattaaataattttaaattgagaatataattaaaactatgtttctcactgtttttagaatttttttaaaaacttttaagcaaaaagcgtttttcgtattacctccacaaaactgctttcttctcctcgtcgctcagattgtattcatgtcctggcagaaattcggtctttcctatacagaacaattattattttacaagttaacagtaaattatgaaaaataaatcgataaaataaaagttttaccgtgagtctcaaaatatccaag