Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W01F3.3   

sjj_W01F3.3 RNAi JA:W01F3.3
Simmer:W01F3.3
PCR_productsjj_W01F3.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW01F3.3 Source_evidenceePCR1166WS150 Sequence/Annotation Release
Overlaps_Gene W01F3.3 Source_evidenceePCR1166WS150 Sequence/Annotation Release
Chunk_score Abs_score1145
Max_abs_score1145W01F3.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV2067320520674370
Overlaps_transcriptW01F3.3 Source_evidenceePCR1166WS150 Sequence/Annotation Release
WB_DNA_textsjj_W01F3.31166tctcccaccaactccaactccagccacggtcgcagtaccggtcccagcccaaactccaaaggtcccacaactcccaattggagccccaggaagtcaagtgcctctcccaaccccaaccacagtgatcgagaaaactaccccaactgttgttgattctcaagaagaggagtacgatgatgaggaagaggatccaatcattcttccagagaccaacgaaatgccaccgatgccaggattggctccagccaacactttcggaaccagccagtttggtgtcaacggattaatcgatgataatgtcgaattgagactcccagaagttgctactacttctagaattgctatcccacaagtcccaactacagttgcaccagttgctccagttgctccagttgcacaacctgtgcagccaattcagccagttcaaccagttcaatcagttcagtcacttccacagccagcagaaatcccacgtgtcgttgtccctcagtccccaggaactccacaaccagtagttccacaagtttcgatcgtcactcctcaggctccacaaccaacagcagctgctacttctgcatcaactggaccaattgctccagaaccaacgactgctgccccgacaactactgaaaccaccccacttccaccatcattggctcctcatccaccagctgctcacgccgccaagactgtaatcccaacatacaaggcagagccagtacttggtcgtgaacaaattccaactgctaacgacggtcaaccaattgttggagcttctccaaaggagaccgtcaattatcaaactggagccaaggcttccggaattagaagctttgatggatcccaagaccaaaagatttccgtagacatcttcaacaagggagccgacggaccaactaaatctattaatggaatgccagcttgtgctaatgggcgtactgaagtcagatattctgatggacgtccagtgatgtgccttccaggaaagaaccaatgcccagacggatcatcttgctacttcaacggaatcgacttcttctgctgcccagaagaagaagatccatatgacaaacacgccttcggaggatatggtggtgatgaaaccaagaatggatacaaagttttcggagctctcaatattagacgactaatggacgaggtgccac