Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W02B12.6   

sjj_W02B12.6 RNAi JA:W02B12.6
Simmer:W02B12.6:Repeat_a
Simmer:W02B12.6:Screen
PCR_productsjj_W02B12.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW02B12.6 Source_evidenceePCR1009WS150 Sequence/Annotation Release
Overlaps_Gene W02B12.6 Source_evidenceePCR1034WS150 Sequence/Annotation Release
Chunk_score Abs_score971
Max_abs_score971W02B12.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1146282111463953
Overlaps_transcriptW02B12.6 Source_evidenceePCR1034WS150 Sequence/Annotation Release
WB_DNA_textsjj_W02B12.61133aagctcgtcgcatcatttttctaacaataaatccacacccagttccatcaggtacagctccatcgctgatcgccacagtcgcagcacgaatgtgatcagcgacgagacggaatgtggcatcttgtcgactatccagacttccagtgtattgcttttttgccagctcggaggtcttttctagaatcggtgtgaacacgtcagtgtcaaaatttgaagttttgttctggacaactgatagaagacgttcgaatcccattcctgtgtcaatgtggttttttcccaaatgtcgaatttgaccacatgaatctctgacgctgctcatgaagacaatattccaaatttctacaactgaatcatcaatattcactaatcgagaagcatctcttccgccgattctatcataatgaatctcggtgcaaggaccacacggaccagctgcacccatctcccaaaaattctcagcgacaaatggaagaattcgatttgacgatactccaattcgtttccaaatttctcgacattcacggtcttccggtaatccgagcttctcgattccaccgaaataggaaacatacaatctatctgcattgattcctagaatttccaccaaatattcccatgcatatcgacatgcttcctcctgaaagcaaataaaatattagatattcagagagaaatgcgtcgttaaacaacttttgagaatgcatcattgaacgaccaattgcccatcatttcaaaaaatgtttgatgatgtaaatcttttccaacgtcatcgagatcgttatgttttcctccggctctaatgcatttttgaatatttgcaactcttctagattcggttgatgatagaattaatggcttgaactgattcattccagcatttgtaaataacaaggttccatcgttttcgtctggaattacagatgaagatctgagtatttcgtgatttttcgatttgaaaaattcgtagaaactcttgcgaagctgaaataaactattaaaatgttatttcaaccgatttaaaacttacttccgaatgtgaatgatagaatccaagtgaaattgatttctgaatattattttccaatattttggagccaattcccatcgcattccggttgaatacacgttga