Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_W02B8.1_b   

sjj_W02B8.1_bSequenceCCAATTTTGTAGTGTTTGGGAAA
In_sequenceSUPERLINK_CB_II
PCR_productsmd_W02B8.1