Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W02D3.10   

sjj_W02D3.10 RNAi JA:W02D3.10
PF:GL1_2C1
PCR_productsjj_W02D3.10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS W02D3.10a Source_evidenceePCR985WS150 Sequence/Annotation Release
W02D3.10b Source_evidenceePCR985WS150 Sequence/Annotation Release
Overlaps_Gene W02D3.10 Source_evidenceePCR985WS150 Sequence/Annotation Release
Chunk_score Abs_score901
Max_abs_score901W02D3.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI67514566752623
Overlaps_transcript W02D3.10b Source_evidenceePCR985WS150 Sequence/Annotation Release
W02D3.10a Source_evidenceePCR985WS150 Sequence/Annotation Release
WB_DNA_textsjj_W02D3.101168gggcgactaagaatacgacgaagattctcgttagaatgaagattttccgaaataattcgaagttgaagatcaacaagccgtataatccgtccacaaacaatatctgacatccataaacattcttcagcttgttctccaattttccatagtttctgaaaggttttcttcatatccatcatggcctgtaaatataaatatttttcatttgaatttatttttaaaaaatcacttacatcatttctatcaaggcagcattgtatcagacaaaggcagagaccaaactcactactcagaactctgtacttgtcggtctggaaatcgattatgaaataaaaactaagcgaagatatatagtaaatttttaatttgaaatgctctattccaatagcttactctgataaatgtaagaaatttcttcgccgattcgacattaatgttcaaaattcgatggccaacagttagacatttttccaaatgctctgatatcttcctttgctccattttctctttctcctcatcttcactaatttcccaagcacaaattattccattccatagtcttccaagtcgttccttttcagtttttgttgttaaaatcaatgatttccatgtcattattgatcttctttttctttcggaatccatatcatccgatgaagtatcgatgccgattttttccacaatgacttcatcacaaaatctatcaatacttggtgtggttattccagaagatgaagaagccgagatttcagaaataagttcaaatgcatcaacgtcttctgtagttttgagccattcgaacaaaatattatctgcagcatctgatccgggaagaagttcatcgtcaagttcaatctgcaaaatttatattattaattttaccagttcactaataaaaagcaaacctgatcgatatccctaactttttttataaaaactgctacaaaatccttccatcgttgattgaatgacatttttgaattattatttttccctctagcaacattttcagtatcatctgcttctccttcagcttgatctttccattcattcgctcttttcagcataattgaaacataatctacgagctgagtgagtccataatttgagatattttctacttgtaccatcaaatcattgtacattccgaagaaatttggcaccgaaa