Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W02D3.5   

sjj_W02D3.5RNAiJA:W02D3.5
PCR_productsjj_W02D3.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene W02D3.5 Source_evidenceePCR388WS150 Sequence/Annotation Release
Chunk_score Abs_score346
Max_abs_score346W02D3.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI67284386729417
Overlaps_transcript W02D3.5.2 Source_evidenceePCR386WS150 Sequence/Annotation Release
W02D3.5.1 Source_evidenceePCR388WS150 Sequence/Annotation Release
WB_DNA_textsjj_W02D3.5980cggatccagattcaagagtagtgataagcttgtctccttcgagccaacgggtgataattgattccttatcagagtccttgatcttcttttgaatgtgaatgaattttccgttctcgaagttgacaactgacttgacggtacggccatctggagtggtctcatcgaattcctgggataaaaacattaaatataagtctgaagaatgctagttcaatttcagggttgaaacaatttttattggatacaattacttggaatttggggataacttgctcaaaccaaaagctcaaatggataggataaaatgttggcaggaatttgctcacagcaaattgtgggcagaaagtcgctaaactttgtccacaattgccgatatcaacgaacgtgcattttgaaatcagatattgtttctcatggctttaaaaaaatattattcgtgcatgaaaaaacacgaaaactatgggaaatacatattgtttatcaaagtcttataacaagaaatcaatgatcattttatgatttatggtttgaaatgttatcacctggaattttaagactttttgtctgtgaatatggaagtaacaatttttattcataaatttgtagtgcgtttctttatttttatgtaacttttttgtcgcaaatttggaatcagaaaacccacattttttttgataacattatttttgtcttttgtaagtaaaaaactttgcactttcttacctgtcccaacttgaaagaaagagtggtgttcttgaatgtggagtattggttggaataccacaaatctccttcgaccttgatttccaaagttggcttcaagttggcagcagccttacgagtgatcaatccaactccaacctccttcatgtactcctcgaagttctctgagtgaatgagcttccagcgtccaacgaattcttgagacatggtgatggttctgtaaatagaagaagttggaaaagcaggtaaaaagttca