Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W02D3.7   

sjj_W02D3.7RNAiJA:W02D3.7
PCR_productsjj_W02D3.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene W02D3.7 Source_evidenceePCR474WS150 Sequence/Annotation Release
Chunk_score Abs_score432
Max_abs_score432W02D3.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI67312796732284
Overlaps_transcript W02D3.7.2 Source_evidenceePCR463WS150 Sequence/Annotation Release
W02D3.7.1 Source_evidenceePCR474WS150 Sequence/Annotation Release
WB_DNA_textsjj_W02D3.71006gctatttattgcatcaaagaccgaacaaaacaagaacaatattcaaaataatctattcacgaatataggcacgacgagagataactgatccagattggagagttgtgatgagcttttctccttcaaaccaacgagtgattacagaatcatgatctgaatccttaatccttttttgaacatgaactacttttccatcttcaattgtgatggttgacttgaattgacgaccgtctggtgttgtctcgtcgaattcctaaaaaacactatttttttaaatggtaaattataacagtcaatttaaaaactgaactttaatggaatgaaaaccgggagttgtttttcatgtagccgacacatttaaagatcgtaactaattcgaaaaaaaaatattttgttagatttaatatgattctttttttgatttcaaatgttcgtttagagttcgcaattgaattttccatagacctattctgaaagacataaacattagattatttcttcatgccacaaagtgtatctatgttaatagaacacccgtttgttgtgtgtagtgttcaaatggatacaaagttcagttgttctttattctcatttttttgtttacactgaaaaccacgtgtaccttcctgcactttgacccactagtttgagtcttatcagtgtttgctagagtttcgagaaaggcatttgaaagtttttaaatgggaaagaaaataactaacgaaaaagccatatagttgttgagttctattctcgtttccttttttcaaaatttcacttaccactcccagagtgaactccaatgtggtgttcttgaaggtgctaagttgattgacatgccacttgtttccattcactttgatctctaaagttggttttgcagcacacgcggctttacgaagaagaagaccaaccccaacttctttcaggtaatcctcgaaattctcggattcgacaagcttccaacgacccacaaattgttcagcagacattctgaaaatttgga