Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W02D3.8   

sjj_W02D3.8 RNAi JA:W02D3.8
PF:GL1_6F2
PCR_productsjj_W02D3.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW02D3.8 Source_evidenceePCR985WS150 Sequence/Annotation Release
Overlaps_Gene W02D3.8 Source_evidenceePCR985WS150 Sequence/Annotation Release
Chunk_score Abs_score922
Max_abs_score922W02D3.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI67345696735705
Overlaps_transcriptW02D3.8 Source_evidenceePCR985WS150 Sequence/Annotation Release
WB_DNA_textsjj_W02D3.81137cctcccggttaacttcatcattttgtgtctttatttgaatatccaaacgtttttgttccgattgattaattcgtcgtagcaatggacccgattcttctctatcgtggattatctccattggtgggaattcgacggaaaccagataattgattaattgactcaaaaattcaacattgggttcggatattggaccattcagcagaaagctggtcatagaaatagatggattgattgtgagtgacatggatgtgaatacggaattgatatgattcataaccaagtcgttgagctcgttccatttctgaaaataagttatatttataattaattccccttgattttaaaattgaaacatctattctacattttcttatctctaaatcttaccgttttggcgaaaaccgatagcttctggaaatgtggctcatttttctgctcatccaagtgtccgagtatttcggctgaatcggaaatccatgagatagcttcagctagaaggcatttggatgaaatcgtacgtgaataaattgtaatatacagcgttgaaattgtgtcgaagcaattgtagaattgttgaactgaaaaaattatgttatcctacagcagaataagaattttctatagatattggaatcggtacttacatccaaatttcttcattgccaatttagatgctaaacgacacgttgacatgatcagagaccaatcgaattcgagtttctgttcgatttctgctttaaactcgtttactattttgattccagtcatctgataatccattcgttttgatttctcgttcaatgcccaaatgacaaaatctaccatcaatttatcagtggattctttttgtggaaatttcaaatattccaagagttcagtgccttttttatatggagcatcggcgagctgtcctaaaatcatcagtctcagcttctgtgcaacattcaggtcagctcggagaccagcgagaacgtggaaagctcttccttgattcggatctagatcgattgctcttgaataatatccaactgccaagcatttctgaatttcttcgtctggcatataacgatgaaaatctccaatgtacatgttccacaatgctgggtatttgtcatcgggaagcgaaagcatttcttg