Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W02D3.9   

sjj_W02D3.9 RNAi JA:W02D3.9
Simmer:W02D3.9:Screen_A
Simmer:W02D3.9:Screen_B
PF:GL1_8H2
PCR_productsjj_W02D3.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene W02D3.9 Source_evidenceePCR1016WS150 Sequence/Annotation Release
Chunk_score Abs_score953
Max_abs_score953W02D3.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI67432546744409
Overlaps_transcript W02D3.9.1 Source_evidenceePCR1016WS150 Sequence/Annotation Release
W02D3.9.2 Source_evidenceePCR1016WS150 Sequence/Annotation Release
WB_DNA_textsjj_W02D3.91156acgcatgattcgtgttgtgtcaattgatacttttcttttccagttgttgacagaacctcgacataattattctccataccaacagccacccattcatcatttggacaacatccaagagagaaaacttggctcgcaaaatcatgcttcgcaacttcctttcgttgtgcaagatcccagcatctaacagaattgtcaagaccacctgaccagagctttgtaccatcttttgagagatcgagacatgatgctccatcttgatgtccaggtagggttccaactttcaccttattatggatatcataaatgaggatatttccatcagcaagacatgcgaacaataatttctcatctggtgacatcgccaacgcgtagcatgcttgtgaatcagtttccaagtccaaagtttttgtttcagttgtaagatcccaaagagcaacagtactggcttctcctccaatcagaagtgtatttccatcttcaaagagtttacaagatctaatatagttctctttgagacaatccaaggatgcaattggaggccgattcacaaccgttgcgccagaaatatctgattctttgacatcccagatcttaacacatccttttccaccagtataaacacgactgttatcacgggaaattgtggccgcacaaactacttctccgtgatttaattccattttcttcttgagacctctgcaattttttttttcaaatttgaatcaaagccaattattatattttcttacgtcggaattccgggacctttctgtgcatctggagggaaggatgtaggtgttggaactccaccgtccacaattttgaatgaataggccggtctgctaccgatttgcccgatggcagctgcaagacgggcctgtgcatggggatcattcaaaaagttgaatcctccagcagcactagcttgtcggagaagatttggatctgaaaattgaaatattttggcattgcctgaagttttggtatttgctccctccacttagcacacttcaaaagattgtaaacacgtactgaatccagctaaaaagttcatttgctccaatccttgaagcccagcgagtggctgctgttgttgtcttgctctagaatttgatgcgatgctcggtgtagatgctcccgatgaggcaacactatt