Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W02D7.7   

sjj_W02D7.7 RNAi JA:W02D7.7
Simmer:W02D7.7
PCR_productsjj_W02D7.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene W02D7.7 Source_evidenceePCR689WS150 Sequence/Annotation Release
Chunk_score Abs_score605
Max_abs_score605W02D7.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV83041728305364
Overlaps_transcript (2)
WB_DNA_textsjj_W02D7.71193aaagggcaaaaatatgatggattgcgaaaaaagacacgtagttgacaggatgcgaagtttaaaccattgtccgtacttcgaagaatcgtttcaagtagaaaatctgtccaacagtcattccaaccaatacgaaagcctcgaaagcggcccacataacgacgcgagagttcgtgttttcattgactgaaaaattgataatttagaagaattcatttgaaaaaactcactatttctgtgaacacgctctctaacttccatgtattcttgctcgtgtttcactgacatcaaagcagaggatagctcacgaaccatttcttcaagcttggcattatcggctgaaagcgaattttataattattgaaaaccgacagtttaaaaatgttttagaacatgtttatcaaaatttgaatcgtgttaaatgttttagtatttcagtggtacttggataagtttgtttaataattattttttaaaaatttaagtctgatctgtcacgataatttataaaactactggccaaactggcgtaagatttaaaaaacgccgattcactcaccagcatcttgattagcggctgctcctggtgcttgctgatgtggctcagtgatttcgacggtgaacattacagctttcggcgtcatcgtgctcatcttgtttccgaaacaataagtgtagactccatccatatgggcagcaaaagtgaactttcctgatgattcacgttctcctttatagatttctttattgtctggtccggtaatctatatttagttgaaattaggtgaaaattttagagccgaagagctataccttaacatcaatatcgaggaatcctccttcagcaacttcgaacatcagacccattttggttcctgacgttaatcgatcgaaaaagcattgctcctcattggcatcaacgtgaatgaagtatgaagcggccggtgtgacgaacaaaactgccagaatccatgtcagcgaattcattttgttagtttttacctaaaatattaaactatatcactttgcgacaaaaaaactatttttaaaaaatagaaaagatgtacattttaagtgagaaacaaaaaaattcacagagacacgtcacaaaaatgagagtattggcaaacgctaaacaaggcgcggtgtggaataacggtgtatcgttgttcctcttttaagcgggtgttcaaata