Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W02D9.2   

sjj_W02D9.2RNAiJA:W02D9.2
PCR_productsjj_W02D9.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW02D9.2 Source_evidenceePCR784WS150 Sequence/Annotation Release
Overlaps_Gene W02D9.2 Source_evidenceePCR784WS150 Sequence/Annotation Release
Chunk_score Abs_score658
Max_abs_score658W02D9.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1253241712534047
Overlaps_transcriptW02D9.2 Source_evidenceePCR784WS150 Sequence/Annotation Release
WB_DNA_textsjj_W02D9.21631gcaacggaatatcggagtgtcgttgtttattttaatccacgtttttccgacatacattccaaaaatcaataaatttcctcatttttcccgggtttttcatcaatttttctgtattaaaaatgaatttcgagtagaaaatcgattttttcacgcgtttttaccatggaaatcctcaatttatcctcaaaattcagtttatcggataaaccctgtcaaaaattcatattttccttattttcagcagttcagaattcccgattcaagattatttcgtttcccgaaatccaccaaaagcctttaccacaggaagaaatgaattcctttggcaatgcctctgtcgacattgacatggtgagtcattctgtggaaaaaatggaaaaaaattaaaaaagacgtgaaaaaaatcatttctttcattcatttcttgatttccaattcctaacaatcaacaacacattatgggcggttcagagtcgaaattgcacgttttcgccacggattcgtcgaaaaatatcgataaagtgccggattttttttggaaaattttgaagaaacacagaaaataattcaaattttcagctggagcaggagatggcggccgagcaaactgcaaatctaagtggaaatatcgctggaatgagtgctccgaaaagctcgtcgaatcgacgaggtccaatgcaagaagtcgatcttgacgccgaatttgacacgttggaggagccagtttgggatactgtggtgagattttttgatttttaagctttaaaattcacctaaattttccagaaacgcgacgttctcactgtcggagcaaaattcacgcacgtcgtgctcccccacggcgataagcagcagcttctccgcgattgggacctctggggcccacttttcatctgtgtcggactggctttgtgagttttcaagcccaaattgggcttaattctctaaaatttcaggcttctccagcacaatggcggcaccgaatcagctccacagttcactcaagtcttcacaatcacattcttcggctcggtgatcgtcacggcgaatattaagcttctcggaggaaatatgtacggattttagcttgaaaaacgtcgatgttaagctctaaatcttaagtattcagcccaaaacctcaattttcaccagaaaacttcaaaaatttacgctaaaaactgctatttttacctcgaaatctcaaaattttagcttataaactcaaattacacctgaaaacttcgaattttttgcctataaatgtgtttttcccccgaaattttcaatttttcactcaaaaatcccaaattttcagctcattcttccaatctctatgcgtcatcggctattgccttctcccgccgttcgtcgccgccgttctttgctcacttttcctccatggaatcgcttttccgctccggcttctcatcacttccattggattcgtgtggtccacttatggtgggggttttcaattttttctgaaaaactcgaattttaaaaatttctaccgcgacgcgaccgcttcgcgcgcggctttcatgaattttccaaaattgtccaataaaattatcaaatttcagcatcgatgggattcttggcaggatgtcagcctgacaaaaagcgacttc