Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W03F11.2   

sjj_W03F11.2RNAiJA:W03F11.2
PCR_productsjj_W03F11.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW03F11.2 Source_evidenceePCR944WS150 Sequence/Annotation Release
Overlaps_Gene W03F11.2 Source_evidenceePCR944WS150 Sequence/Annotation Release
Chunk_score Abs_score862
Max_abs_score862W03F11.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI22259662227149
Overlaps_transcriptW03F11.2 Source_evidenceePCR944WS150 Sequence/Annotation Release
WB_DNA_textsjj_W03F11.21184tctaggtcaaaagcggaggatctggttatcacctccgagcagatgatcccaaagctatagatatcagcctccttgctccgttgctccaggccccgtaatacctccggagcccaccacaacatattctcagtgctcaatttatccatccctctgacctcattcaacccaaaatctgatatcttcacttgccatcggtcatctataagacagctccgagagctcaggtatccgtggaaatggagcatcgaggtatgtataaagccaagcccattcgcgatatctctgattagggataacatgaaaaagctatccatttgcattgagcttctgctaatgacatcggccagtgagcctcgtgagcaatatctccaaatggagaggagttgttgggagtttagacagagcccaatgaatttgtttaggttgtcgtggtcgaggcttctcatctgtaaagagcaattgtttcatgtaggcgttaaaccgcctgcgtgcctgcctgaccttccgcctgcctctcgcctcaatacacgctttagaatcatggtgcatcgattactcttgttgaataaaattgcattacaagttttccaacatggtgcatcgacgaaaaataactcaactttggcttgaggtagggcatacttgtaggcgttaaaacgcctatctgcctgactttaagcaaacctccgcctgcctcaacaaaacataaaaatgtggaaaaaaggcgaaaggccggcgtgaggcgggcaggtttcaggcaggccctaaaatcgcgcctgcctcgtgtcgtcaacttttttgaatggaaatgccaaaaaatcacaaaatgccttacatgtgacgtcacttttcttctagcgtaatggaagaggtgtgacgtcaccatctcatctctaggccatacctgtctcaattcagacctctctacatctgtcagctgcggtcggaaatcatgtttattcgctgcgacgacctcgttctgaaaaatgaaattttgaaaataaattttgagagtaaagttcttacatttctcacctgataaatgtagaaaatgaatcgagtggtctcggtgcgactttcgactgttaacttggtcgaagtggatggtccacttgcgaaggagcgttgactggcttcggattttgactgaaattcagacttttttagtttgaatcaggggtcgg