Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W03F11.3   

sjj_W03F11.3RNAiJA:W03F11.3
PCR_productsjj_W03F11.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW03F11.3 Source_evidenceePCR552WS150 Sequence/Annotation Release
Overlaps_Gene W03F11.3 Source_evidenceePCR606WS150 Sequence/Annotation Release
Chunk_score Abs_score480
Max_abs_score480W03F11.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI22337732234901
Overlaps_transcriptW03F11.3 Source_evidenceePCR606WS150 Sequence/Annotation Release
WB_DNA_textsjj_W03F11.31129aatcaatcaaatcgcaatttttgtggagaccgtggtggcgggagcttgaacgttgttgattggagaaaccagggagatgttcaactggaatattgattttattgattttcaagatttttgaatttatgccttggtgtaaagacgctccaacggccactcattgtacgatcgcttccaaagagctcgggcaattgtacgcgattcctggaaatttttaaaattttttctaaaaatttttgggcgatattttctcctctgcctcggccacaccacaaaatctcaccttctcactagtcggctgaatttcatcaggaactctcagacactcgacggccaacttcaaccgcttctgagtgtactctccgtatgccagtggccaatcgtccgacgacatcagaaacagtttgatgacttttttctcgccgggcttcaggattccacacgacgagtcgactttgaagatcttttcctggaaggtaggtaggtaggttaggcgtcgatttttgaagaacaaaacttccttactcttgccttgatgttgtatgcaacagtatgcggatcacgatttgcaacaaagaatcggacgtaaagtggagtacggtattcgttttgcgagtagaagaacagccatctggaagttacagattttattgtaggcaggtacattttcatgcctaggcaggcgcagtttgcttgcctaccccaggcctaccttgcgcctgcttgcctactttatgcctacgtacttatttatgcatgtctacctatacaccgatctcacacctggcgccttgcttgccaattccaaagctgcctatctacgcgcctacatgcctacctgtctcctcaatcttagctgcctacatgcctacctgcttgcgtgtctgtctcacgcctgcctacctgcctaacatacctgggataaacgacaagatcctgatcaggggacgtgcatttcatttgcatggttgtaacttccgccgatgttagcacatttttttctgaaacttccttttagtcttccgattattgtagaatcgaccagaaactcaccatttcccgcaatttgtgccattttttgatttgtctagcttgagtttttgtccagaaaagaaaacggagttcgaat