Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W03F11.5   

sjj_W03F11.5RNAiJA:W03F11.5
PCR_productsjj_W03F11.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW03F11.5 Source_evidenceePCR653WS150 Sequence/Annotation Release
Overlaps_Gene W03F11.5 Source_evidenceePCR653WS150 Sequence/Annotation Release
Chunk_score Abs_score569
Max_abs_score569W03F11.5
Specificity_index0.575
Rel_score1
Map_statusUnique_ePCRI22171192219393
F19B2.4 Chunk_score Abs_score96
Specificity_index0.097
Rel_score0.169
F41H8.3 Chunk_score Abs_score324
Specificity_index0.328
Rel_score0.569
Overlaps_transcriptW03F11.5 Source_evidenceePCR653WS150 Sequence/Annotation Release
WB_DNA_textsjj_W03F11.52275ccacgtggaatctaccactttagtgacaccgaccgagacatcgaatcgagctttaaaattccagattttgaggcagtgagatacaattttcaattcaattcactaactttttccaaaaatttcagctggatccaatcagattagcctccgacctaatgtcatccgcaatgaaagttgacacaaaacgaaagacactggcgggaattcaaatgccattttcactaacgggaaggcctatgaacttacagattgatggagaatctcatgatgccgttagtttagtagatgatcctaagaagaggaacaatgagaagagcatggaagttaggaggttagtgagggatttgtgaatgggcgcctacctgcctacctacatgcctacctatctgcttataagcctgctacttttgtagatttaagcaactcaaatttgtttttattaattcttaaagttgctgcgaaaattccgattattccgatattcagtgtacctcagagcaaatcaaaagacgaaaaattcctggaaaataattaagaaaaattcgaaataaaatttcaaaaaaatgcctacctacctgcttataagcctgctacttttgtagatttacgcatattaactttgttataataattttttaaggttctgcgaaaatttcgatttttcagtgtatctcagagtaaatcaaaagtcgaaaaattcctggaaaatatttaattgtgaaaaattcgaaataatttttttttaatttctgggaaactgttaatctatcgaaattacgccgagtttcattagaaaaaaattctccaaaaaaaaatttcccagaaattatcaaaaactgggagattttcttaaaatttatgaaaattattttattcaaaattgtatcaggtaccgatttttgtaaaattgtaccgatttttttttcgaatttttttatcgatgcaccatgtccaaagtacgcctatttgtcatggggaactattggattactgtagtggcactctaaaaaatttgaaacccaaaataaaatataaccgagctaaaaaaaattcctaaaaaaattaaattaaaaacaccgaaaacttaaaaattattagaaaagtcaaatttacttttttttcaattttcagattaaaattcaaaaataatttccaaaaaatagacaaacttgcaaatgtggtattcaaaaaaaaactagaaagcccaaattcacgttgcaggcttaggtagccctgaaggctaacagaaatctctcaaaatcggccatcgatgcaccatgaccgaaaatgtgcatatttgccaagggttaatatgtattttggattattgtagtgatactctaaacatttaaagtccaaaataaaatttaaaacaactaaattagttttgccaaaagttaaatgttaaaaattatattaattttttaaggtggagtagcgccagtgggttgaaattgttgaaagccactcctttggtcccaaaatgactaaataccatgataaaacttttcaaaatatttttgaaaattttttatttactgtcaaatagtgataattactcagtttttgcatagttttgaataattttgaaagtcgaccaaaaaaaaaattgtttttttcggcattatttatgtatgttttaattttgtttaaattatttgtattaaaacattgtaggggtaaaaacattcgacacattttggtaatttgccaaaactttgaccggaaattatgaaaaatctaaacatttttggagtgttttattatcacacattttcactctaccaacaatttggcgcaacttctatacatcactcaatgccaatacaaagtaactatttccaggtccgacatgactccagactcgcggcgagcatttttacgggctcgtcaggtatgcctcgagcagtctgcagattcttgtgacgaggcattagacacattccatcgcgtacggtacgggaaatcattgctcggtggggaggaggacggagagagtgagcaatatcggagcattatcgaacgaaggctcaaggaggtgactaaggtatcgtccaatcagcgccattggccacgcccctttcgctcattggtttcagtttcagacgtcacattccacatcatcaccaccaggaacttctgatccatatacggattccggatcccatgaagaatcggatgaaatagaggagaatctggagccgctttccagaaaacccacgtcatcaggccgcttctcccatatcacattaccaaaatatcatgacaaagcaca