Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W03G11.1   

sjj_W03G11.1RNAiJA:W03G11.1
PCR_productsjj_W03G11.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW03G11.1 Source_evidenceePCR908WS150 Sequence/Annotation Release
Overlaps_Gene W03G11.1 Source_evidenceePCR994WS150 Sequence/Annotation Release
Chunk_score Abs_score952
Max_abs_score952W03G11.1
Specificity_index0.726
Rel_score1
Map_statusUnique_ePCRX1210494312105993
C34F6.2 Chunk_score Abs_score111
Specificity_index0.085
C34F6.3 Chunk_score Abs_score111
Specificity_index0.085
Rel_score0.117
Y41E3.2 Chunk_score Abs_score137
Specificity_index0.105
Rel_score0.144
Overlaps_transcriptW03G11.1 Source_evidenceePCR994WS150 Sequence/Annotation Release
WB_DNA_textsjj_W03G11.11051atataaaagcgggcgatgtgacatccaatgtatcagttccatcttttctgctgttttcaaaggtacttcactttctattcacctcatttcactttcaattatcactttactttttccagatgacgatggataagaaattcgaaaccgagaaagtgaagaggttcgcattcttcggaatcgctgtctccacggtgtctaccctcactgccatcgtcgccgtgccaatgctttgtctttacctccaatcggtctcttcttcccttcaagatgaagtcaacttctgccgagttcgtgccacttctcttgagggagagcttgccaagcttaatgtagtccgagctccaagaaaggcacgtgctgctgagggaacctgctgctcctgcggagttggatcagctggaccaccaggaccaccaggatttgatggatccgctggaaaggatggatcaaacggacgtccaggaaacccaggagaggatgctgatggagatgactacaagccagatgcaagccaattctgcttcgactgcccagaggctccagctggaccaccaggacgtccaggaccagacggagagaacggaggagctggagagccaggacgtgacggacttgctggacgcccaggagctcgtggatcaccaggaccacgtggaccatctggaaacccaggagctgatggaccagcaggacaacttggaccacaaggaggatcaaacgttgcaccatctccagccggagagccaggagcaccaggagcccaaggaccaaagggaccaccaggagccgctggacgtccaggacgcgacggacaaccaggagcaccaggagaccaaggagagaatggaccagacggagccccaggaaaatctggttccgacggacaaccaggagccccaggaaaggaaggatcccgcggaggatgcgaccattgcccaccaccaagaaccgctccaggatattaattccttcattagaaattatattagccaatttcacttcttctctttcaatgtgtttcttgtttcattcaccacaaatgaactgccac