Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W03G9.6   

sjj_W03G9.6RNAiJA:W03G9.6
PCR_productsjj_W03G9.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW03G9.6 Source_evidenceePCR808WS150 Sequence/Annotation Release
Overlaps_Gene W03G9.6 Source_evidenceePCR808WS150 Sequence/Annotation Release
Chunk_score Abs_score724
Max_abs_score724W03G9.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI49848214986001
Overlaps_transcriptW03G9.6 Source_evidenceePCR808WS150 Sequence/Annotation Release
WB_DNA_textsjj_W03G9.61181cacacaatgagtttcacccgaccgtaaatctcattagtgatgaatgtagtgtacttttcatctttcaacttctgaacaccatctttcccatctttcaaaaatgacaatgtgagttcaattgcagattgcatacagagatatggctcagtaggtccctgaaaataaaatacgctatttaataatcgaaaaatcaagagatttatctcttaactttaaaaaaattatttgtaatcaaatttaaatcacactggctacacctccaatcctctcgcggattggtgggttctcgtctaattgagtggtcacatgaaatttatgtcagttttgagtcgaaaaaattttactctctaatttctaactttttgatatgtattttagtctataacttctcaaataaaaatcaattacatgaactccgaactgcttggcgagccaatttggaaaaacaaatgggaaatcggtaaaactctgatgaacagctccacttaaagtcaagagaatgtttccttcgttatttggaagaattttcctcataacttccaaattctcattccactgccaatctccaacatttaggaacattatcggctgttttgcctgctcctgttgattttgatccaatggatacatccatccatccaatacaattgctttttggaaatccgaggaagaagaggcaatgctagttgcacctccaaaagagtgaccaataattgacgcagtcgtcgtgagaagcttattcttgaaaaattccagatttgcgttgtttccaatgataactttatctttaacgtttccagaatccaactgctccaagattttaaccgccttcgcacattcttcggcccgtttcccgaccttaaaaataaatttacagggaaaattaaaattgaaaactcacctgttcatttcttatcttaaactgatccttatcatttctgtcgactaacttgattttcataggtttctcaacaagagtcccatttttttcaacaagtttataggtccagcaagcggaagaatctctgaaacgatttcagtgaaatcaataggctacattgaagcgatccattagaactcgaagaatcttttaacagcatacctatgctcaacagcagcgacaacatatccatgtgaagcaagagatgtgcaatatgttgagtagaatgttcgagagccgc