Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W04A4.6   

sjj_W04A4.6 RNAi (3)
PCR_productsjj_W04A4.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW04A4.5 Source_evidenceePCR686WS150 Sequence/Annotation Release
Overlaps_Gene W04A4.5 Source_evidenceePCR710WS150 Sequence/Annotation Release
Chunk_score Abs_score647
Max_abs_score647W04A4.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1366327813664476
Overlaps_transcriptW04A4.5 Source_evidenceePCR710WS150 Sequence/Annotation Release
WB_DNA_textsjj_W04A4.61199gggcaagtgagaggtgagagacgacgagagcgacttgcttgcgcatttcacgcgcacgaggccgtgataaatatttgaaataaagaagttccctccgtaaatcgtgttgactgagtattcaacgttttgcacgcgttcaggtacgcagcgaattgagtccagcggagcgcacttgccttttttacatttttaatgaaaatattttcgaaaaatacattgcggaaccgaattttccagtgaaaaatgctcaccagagctcctcggaaacgtgaattgctcggcgagccacaactaagccagcctccatcgaaaaagaatcgtttggataaacaagcggagcgaagttttcgaagaaggaatctacaggaggttctcgatgagctgtgccttcgagtggagagtaacgatagacaattgtaatgaaaattgatttgaagaagcttaattaattaaattaaatttttagaacaaataatctcatccgggagatcgacacggagcatgtacgggttatcagagataaggactttgcgaaaagctgcacaaagctcatcaaagcttgtttgacctcaaaagtaacattaaaaactacttaaaatctcctaaaactataaaaaacgattaaaaatcttaatttcagatcgaaacagtctcaaataagatgtttgcctgtttaatgggaatgttcgcacgtggatctttacaaagaagaaaggatttcgtgttttccctccaagaagtctgtgaaggattatcccaagcaatcaaagagcctgcaaagatccttccggatcccagaagaatcgtagaaacatcgaatttcgactcgggcgcggaatccgacaccgattcagaagcttccaataaaaaaccggcggattttaagccaagaatcgaagatattctgccgatggatgaggaggaagacgagatttcaatgattgatgcgttgtatttgaagccaaatttggattctggagtgctcacgatttatacgatggttctccgagagaagattattcaggctgacgaagttccggagaagtacggaattttttaaatgtgaaaaccatctaaaactcgagaaaatcaaatggaatttggttgaggctcaggctacaaactacaaaaagtttagcctcaaccaattgttaatttacacgtggaaatgattatttccggggtttgaagctttatga