Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W04C9.1   

sjj_W04C9.1 RNAi JA:W04C9.1
Simmer:W04C9.1:Screen_A
Simmer:W04C9.1:Screen_B
PCR_productsjj_W04C9.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW04C9.1 Source_evidenceePCR874WS150 Sequence/Annotation Release
Overlaps_Gene W04C9.1 Source_evidenceePCR874WS150 Sequence/Annotation Release
Chunk_score Abs_score769
Max_abs_score769W04C9.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI491171492345
Overlaps_transcriptW04C9.1 Source_evidenceePCR874WS150 Sequence/Annotation Release
WB_DNA_textsjj_W04C9.11175aaaaccaccaaacccaacaatttttccagcacaatcgacctattcttgctgcaatttttccgttttgcactatggatggtgccggcggcaatccacgtggccaacaaggcggacacgttgacaatgtggaaagaggtcggtggccgcgtggcctagaaatcccgaaaatttcaaattttcagccaattttctgctcggcactgctcatctgcgcggcgagccccacaaaattgctcctcctcacagaaaagctgaagcccgatgagttcctcactttcggcgacactgccttccttgtctggaatttcatttccgcgatcattttgaactcctcgtggacaagatacttctcgcgaactccgtcttcatatataattctggaggatgaggatgtaagtgcgctccgctgagaaaatgttttgatcacccccacgattttcagctcgaggtggctccaaaacaaacgtttgagcttattttccgcctgctccaatactgcaaacgtgaatggctctggcatatttccggattctcgtggctctttatttattcgatcagtaagagaatatccatcgggggttttttgtttcgaatttaaaaaaaaacacaagtggaagagtttttaagatttctaggccacgcacccactccaaaaccccaattttcagcccgtatcttcgttccctattacacgggacaagtcatcgctaccgtggtcgccacaaaatcgtacccagccctctccaacgctgtctacatcatgacaatcatctcgttggtgagcgctgtcgccgccggattccgtggaggatccttcgagtacgcctacgcaaggatccagagggcaatccgctacgatttgttccacggactcgtgaaacaggatgtcgctttctatgatgctcacaagaccggagaggtgacttctcgtctggctgctgattgtcagactatgtcggatacagttgcgttgaatgttaacgttttcctcaggtaggtgtgggtccgtgaccgaagttcccagatcacatgacctaattttcccaaattcttccagaaactgcgttatgctccttggatcgatgatcttcatgatgaagctttcgtggcgcctctccctcgtcacattcatcctcgtcccaattatcttcgtcgcctccaaaatcttcggaaca