Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W04D2.5   

sjj_W04D2.5 RNAi JA:W04D2.5
Simmer:W04D2.5
PCR_productsjj_W04D2.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene W04D2.3 Source_evidenceePCR98WS150 Sequence/Annotation Release
Chunk_score Abs_score77
Specificity_index0.12
Rel_score0.137
Map_statusBottom50_percentile_ePCRV1249571412497324
W04D2.5 Source_evidenceePCR755WS150 Sequence/Annotation Release
Chunk_score Abs_score713
Max_abs_score713W04D2.5
Specificity_index0.88
Rel_score1
Map_statusBest_ePCRV1249571412497324
Overlaps_transcript W04D2.5.2 Source_evidenceePCR627WS150 Sequence/Annotation Release
W04D2.3 Source_evidenceePCR98WS150 Sequence/Annotation Release
W04D2.5.1 Source_evidenceePCR755WS150 Sequence/Annotation Release
WB_DNA_textsjj_W04D2.51611attaaattgttcaaggcaatccagctaacctaaatacgggttgatcctcacgaaaaaccattttaatattgaatttcactttgcgttcccattcactttgctattgaacttgtacaaaaataaagaatattaattgttttaaaaaatcataaaaacaatcaacaaaacaaaaatggaagaaatctacctacgttagaccaatcttgatcttgaaaattggaatttacacaaataaaaattcaaactggaactaaatacgacgaatcttgcgtggccgtggtccaagttcgcacaatggagtgtgatcggagatgctgacaacatgaacaccagcaactgtgagacctttgacacatgtcatacgtccgggtccaagacctttaacttgtactcgaacagttcgaattcctcttctgacaagtctctgtccggctgcaactccagttgtctgaccggcgattgttgtcttctttctggcatttttgaatccctccagccggcatgacgttgatgtgattacttcgttctgaaacagaattgatattatttttttaaaggccgctttaaaatacccaaaatagtctaaatttcagaaacactgccaaagaaaaacggaaaaaatcgataaataatgaaaaatccaacttttaaaaaagcgattatctcagctatggtaattttgaagcgaatttaaggaaatttagccaaaattgagaacatcgcattttaaaagttgaatccttccctttttggtaaagttttttttcgaaagagaaaagtcttttcgccaaaacacgaaaaaaaactgaagacttaaaattttgtaatatgtattggaacgtttttttgtaaaatttaaatatcttgattaaaatttaaaatttttataacgtcttttttttttgaaaaaattaaaatttagtttttcagtatatcagtatttttgcttttttcgctcactttttttttgaaaaataaatgttttttagtcgggagaaggaaaaaaacaagttttttttttggaaaaattcgatgttttgttttttgatccaaaattcaaacaaaatttttgagacggccctgatgacgtcacattttaaaataatttcgccgcaatttcagtagatctactagataccgtattcaccttattatccataacagtgactaatgtgttatttttgctagcacgaatataaaccaatggcagctcgtgatacgcaactccatcaaattgttgtttcaatgtctcagcagtcggaaggcgagcgtctatagatgaagtattgactgcagtctgaattccagctcctgttgttccttccattgtttctacttgtcctgttccaattctagttccttgtctatgtgcatcacgaatactatctgctgctcgaattgaagcatggattgctctgttttgttgaatttccatcgattggcttgcagtctgtaggcacatacgacccaagtcacttacaagacggcggagagacatctgaaattaaattaaatgcttctatcaacagaaagtagatagtaaataaaaaatatataaactaggcttggaaacctattagaatagtaagatacggggaataaaaaccattc