Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W04D2.6   

sjj_W04D2.6 RNAi (3)
PCR_productsjj_W04D2.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS W04D2.6a Source_evidenceePCR798WS150 Sequence/Annotation Release
W04D2.6b Source_evidenceePCR798WS150 Sequence/Annotation Release
Overlaps_Gene W04D2.6 Source_evidenceePCR939WS150 Sequence/Annotation Release
Chunk_score Abs_score876
Max_abs_score876W04D2.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1250515712506246
Overlaps_transcript W04D2.6b Source_evidenceePCR798WS150 Sequence/Annotation Release
W04D2.6a Source_evidenceePCR939WS150 Sequence/Annotation Release
WB_DNA_textsjj_W04D2.61090aggaagaagaagcaatgcgaaaaatgcgagctgatagtggaagtccaaatcctcatcaaccacttggtcaatcggcaaacggagaaaagtcttcgagtgaagaagagagtgatagcgaaaagaccgatgtcaaaaaggaaattaaggatgaaattaaagaagaaccaattgatgtagatatttccgagcatgtagatcctaacactggttcgtctggtacaaatggaaatttcggatggaaagcgattggagatgactcttctctcaatacaaaaataaaccgccctatagctaacggaaatcaaaatcagccgcaaattaaaaaagaagcatctcctattccaattgctcaacgcctcagtggtgtgtttggaaatgatgacgatgaagacgatgtgcatagcaaaaagaagttgaaaccattcgagatcactagagaagagcgtatgcaagtcatgtcagctgaagaaaaaagagagctgacgaagcagataatcaaaactattcctgctacaaaaggcaagttatttcgaagaaaacgttcataaactttgagtttttatggtaaaatcaaagatatgtttattgaaaaaaaaaacatttaaaacttgatttttttcagatgaactttttgttcatagaatcgaatgggatcagctagatgggaaatggatgaatgatcgaattcgtccgtgggtggctaaaaaagtcactcaattccttggcgaagaagacaaatcgttctgtgatttcatctgtgatcaaattgagaaacaagcgacaccccaagaaatactcaaagacgtcgccgtcgtgagatgatcaattattaagtaaaaatctaatatatggaattcagatcattgacgaggatgctgagcaatttgtgatcaaaatgtggcgacttttaatttatgagggacaagcccgtcgtctcggaattacataactactttcaatattggaaatacattatgcaatctttttaccactcatccccgcctctgtattgagttgttctttacttcaaagactcgttttactgtctatttctctctccctctctggaattcattccagtgagcagctg