Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W04G5.5   

sjj_W04G5.5RNAiJA:W04G5.5
PCR_productsjj_W04G5.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW04G5.5 Source_evidenceePCR920WS150 Sequence/Annotation Release
Overlaps_Gene W04G5.5 Source_evidenceePCR920WS150 Sequence/Annotation Release
Chunk_score Abs_score794
Max_abs_score794W04G5.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1163525511636940
Overlaps_transcriptW04G5.5 Source_evidenceePCR920WS150 Sequence/Annotation Release
WB_DNA_textsjj_W04G5.51686gcttacagaacgcctccaagaatcaccgccacacaatttttcgggcaaatcaatcgaattaacattaaatccaggagaagaatatataaagtttacatacgatgtcatcaatgatgtatattcacattcaccaaaaaaaggattcatggcccaagcttattatatggaaaatatgaaacgttgcgaagaaccggatcacatcatggttcatttatgcaagatatccattgatgatgaagcaactgtattagaaaacaccactattaaacataatttattaattgtgttcagatttcctggcactttgatttaaaatccatagaacgacctattaaaaaagttgaagttcgcatgggtggatttgctgaattcagtggttccagtttagcgagagcgaaagcctgtattggaaacgtgagaagtgtagtagttatgctgatcacatgaagttgttgtttaaggtatgtagggtactggccaataacaatattgaaaggatcgataacccagatataagcatttttacagttactgtgggtttgaattcaatctcactaatacttaaaataatttatttaaggtaatgttgcttggcaattctcaaattttccgaaccaattggaataaaggaaccgaaattgaaagtttcttagttagaatttatcctggtgagtgcacatcacatttttgtcaaaccgaaaaatttgccgaatttgccaaattaaaaatttgccgcacacatttatgtagtttgacccaccagccgtccgcgggtttttaactgccgttgcgtcaattttgggacttctgtcaacctgttctttagcatttaaggaattcaatttcgttagcatttcagaactgtcagattttcagatactcccgaagattccatttcaaacaaaacgttgggcaaactaatcgaacttcctttcaactctggagaagagtattcaaagtttacgtacgacatcattaatgatgtatactcacattcgccaaaagaagggttcatgtctcaagcttattatatggacaatattcaacgttgcgaagaaccagatcatatcacggttcatttatgcaagatattcatggaaaaaaccgcaactgtattagaaagcagctttaaaaattaaatatcacatataatttacagatttcctggcactttgatttgcaatcttttggacaaccaattagaaaagtggaaattcgtataagtggatttgctgaatttagtcctgatgacagttatgcaatggcaaagtcatgcatagggaatgtaaggaatcttgtggtgtatcttttaaaaaatcgttgtttaaggaatgcattaaaattatcaatgacaatattgcaacattcgagaatccaataacagatgttttaaaaattaccgtgagtttttgttctagttatgcagttccaaaaagagaataaccaaattaaggtaatactgagtggcaatgctcaagttttccgaaccaattggaataaaggaactgagattgaaagtttttcagtcagaatttatcctggtgagttcgcaacatatatacatatatacatataaacatacatatattcatatatacatataacaacaccccaattttctaattttcagagctaccaaattgaaaggcattcaaattatcattgcaaacggaacttaagcgggat