Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W04G5.9   

sjj_W04G5.9RNAiJA:W04G5.9
PCR_productsjj_W04G5.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW04G5.9 Source_evidenceePCR615WS150 Sequence/Annotation Release
Overlaps_Gene W04G5.9 Source_evidenceePCR615WS150 Sequence/Annotation Release
Chunk_score Abs_score501
Max_abs_score501W04G5.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1164436311645443
Overlaps_transcriptW04G5.9 Source_evidenceePCR615WS150 Sequence/Annotation Release
WB_DNA_textsjj_W04G5.91081aaacggctttgtacgaataatgatattatgtagaaacctcaccatctactctgagaactacaacaaaaccacctactaccacaacgattgctacaacaagaatcactactagtaagttatgctgaaggtttgaatttttaccaaaaaaaaagaaacattaggtcgatttaacaacaaagtcagttccgaaatctaccacaaatttgaatttttagagacaacaacttctccgccgccatttacaacaacagtcactactactacatcagctgctagaactattgccacaacaagtaagttcagcttgctagtgcgaattttagtgcgtatcctttaagaatatagctttttgcgcataggttatcaataataatgaatttcagcacctataaaaactgttccaccggttaaagtgttcggcaaagcaatcaaaccgataccaacacctggagaaaacatcctcgattttgagtatgatattgttaaagacaagtactcccaaagtccggaaaatggattattttctcaagtttatgatgtgaagaacatccgacgtatcagagatactaatacaaatgaggtttattttggcttggtcgatggagctgatcatggaactgtgagtgggtgtgaatttaacagtgtataatggtacgactttcagatttcgtggcgctttgataaagatttaaataacaacaagattggaagagtagatatcgaagttcgagatgatgaagaatatagttacaatggcaaagcaatagcgactttttgcatagctgatgtaagaaacatgttaccgttttgatatcagttgtttaattttaggaatgctggatcattcgtagaaactcggttacaagtatttacgatacaaaacacggccaaatcaacgtcatagtaaggttgtatgtagttaattctgatagcagttataatttcagttcattttgactggtggcgacgcacaaatatttaggagaagtttgggagaggaagcacattttcccagttggaagttgacagttcacacaagtgagtaaaaacaccgtaggtcttattctcgggtagtggacaa