Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W05F2.2   

sjj_W05F2.2 RNAi JA:W05F2.2
PF:GL1_2B10
PCR_productsjj_W05F2.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW05F2.2 Source_evidenceePCR819WS150 Sequence/Annotation Release
Overlaps_Gene (5)
Overlaps_transcriptW05F2.2 Source_evidenceePCR879WS150 Sequence/Annotation Release
WB_DNA_textsjj_W05F2.2975gacctaaaaacgggggaaaatcacaagtaagctgagaggcggtgggggctcagaagaacttcaatcgtgtggcttgtccacagtgacgaccgcttccggcgctgcttgttccgatgtcgactccttcttcttcttcttaatcaaggacggtgggagcgtcgtattttccggggtgcctggcattggcgattgcttctgaaaatttgaaattttagataaaaagatcatgcgatttaagctaactggagtctggagcttctccttggtggccttttcggtgactggaagcatctgagcttggtggagcagtgggaccaagttcgtcaaatcagtggacagcttcggggctttgcgcttcgacgattcagccgccattgatcttcccttaatctgaaaacaaaaatcgttgtgagacccagcgtgtgccttcaaacttacatgagatcccggtgtgagtagagcgtcggttttcggcgtttccttggtgggttctggcagaactgtcttctgttgtggctccaatttcacagagaacacgtccatcttcatgtgcaccggtgacgtcaattcaagcttcagctcaagacgggcatcgctgaagatctccttcgccaaggtatccgatgagcaaacgaacggcggtccatcatcaagatatccgtgcaggaaaaccttctgctcggtcattttctccacatgatgttgcacgagctccaaagcgtaccgtgccttttcctctgtcgtcaccagcggcgcagggagatccaaatcattgatgagcgaaatgagctcctttccacgtccccaattgtcggcgatcacttgcaagtgacagcttattgcttcttccttttgagcggtcttggtccgactctcgtatggtccgttgatcgagcctgctccgagggctggtgtgatgggcggggccaccgcggatcgtcgtttctccatcacttttgtgacgtttccattgga