Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W05F2.5   

sjj_W05F2.5RNAiJA:W05F2.5
PCR_productsjj_W05F2.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW05F2.5 Source_evidenceePCR789WS150 Sequence/Annotation Release
Overlaps_Gene W05F2.5 Source_evidenceePCR789WS150 Sequence/Annotation Release
Chunk_score Abs_score726
Max_abs_score726W05F2.5
Specificity_index0.916
Rel_score1
Map_statusUnique_ePCRI33715803373521
K10G4.7 Chunk_score Abs_score67
Specificity_index0.084
Rel_score0.092
Overlaps_transcriptW05F2.5 Source_evidenceePCR789WS150 Sequence/Annotation Release
WB_DNA_textsjj_W05F2.51942gtacgcaacacacaacacactttgcgtacttgcccaattagacgcgcaaactttttaaaaactttttttgcgttttttaaaaatcgctttaggaacttttattctagaaagctttctctttcttcttttcttaccaaagagaataatcccttttttcaaaaaaatcattatttttcagaatctgcaaaaaatgtcggaaattatcaagacgccttgttccgagaaatcgtatgttactcaaaaacttacataataaaatctcaaaataaatattattgcagagatttcatgaaaagtctcgatactcttcgtaccaacagaaaaatgatccatggatgtattctctacgaatttctccagaaaaaaacagcgttcgaagcttacgaaagtttttgcaaagtagttgggaggaaatcattgaatgccaggagttttatttctggtttagccggtttgaaaaaggaatggcagagttcgatgagaatatcaagtacgagaaggatatcaactggaaaaagccgaaaattctctcattttctgacatcccaatctcagttattcatgtaattctggaccatgtgaagcctgttgaaaggtaaaacacgtggtgtcagagtgtctcatttcggcttgatctacgttgatctacaagaaatgcgggagaagagacgcagagttcttaactgatttcgcatggttaagaacgtgctgtcgtcacaatttttgggcaaaaaaattaccgcattttttgtagatcaaaccgtaatgggacaatctggcaccacgtggtaaaatcaaataatttttaaaaagtggactacaccttgtggggaaattgctttaacacacgcctatgggaccacaatgaccgaatatcatgataaaaacatttttaaaaagttttctagattttatatgattttttgaaaattgaaaaaatctcagttttcccctaattcctatttgaatttccgccaattgaactcgttcgttggagcgcgcttgcattgttttcattaatttttttttcattatttcactgattttcttcgttttttgggggtttctattcggaaaaggaaagttttttctttcatttttttatttctttcattttccgaataaaaacccccaaaaaacaaagaaaatcagtgaaataatgaaaattaataaaaaaaatactggcgcgctccaacgaacgagttcaattggcggaaattcaaataggaattaggagaaaactgagattttttcaatttatataaagtctagaaaatttttttaaatgtttttatcatgatatttggtcattgtgaccccatagacgtgttttaaagcagtttccccacagagtgtagtccaccttcaaattgaatatctgattttttttgcagactcgttcttcaaaaagtgtctcaaaaactgagaagtatgcttttatcaagaaatcatggttttaaatggatcgaattgcatgtggatattaataaagcatggctgatgcttgaagaagaaaatattcgagttgattacactcttctacattttgacacttgcgtgagctttgagcaacgatctggatcaatcgatggtgaagattttgtgactgttgcactgaacgatgctgctccattcatgctaaatccgaaatatccattaaacgactttcaagttaaaaatgattgtcgtggatgggctcaggatgatgacatctcgtatggcaccacacaacgattgaaaatcgctgtttccagtaaaatcgagagagctttcaattcatttaacgctgaatttcacgttaaaagccttctaatcgacataattggagtgaagaatacgagttaattgaggatctagtcgatcttgagcaatggaaaaacgcaaaagtgatcaaatcggaatgtttttctcgtctaccgattgaagtcgacgaatacttcca