Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W05F2.6   

sjj_W05F2.6RNAiJA:W05F2.6
PCR_productsjj_W05F2.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW05F2.6 Source_evidenceePCR692WS150 Sequence/Annotation Release
Overlaps_Gene W05F2.6 Source_evidenceePCR732WS150 Sequence/Annotation Release
Chunk_score Abs_score628
Max_abs_score628W05F2.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI33686433369841
Overlaps_transcriptW05F2.6 Source_evidenceePCR732WS150 Sequence/Annotation Release
WB_DNA_textsjj_W05F2.61199caaaagaaaatccaaaaattcccgcaaaaaatggcgaaaaaactcaaattttcgcgcgcaaatttgaaaaagtacgcaaacaccgccactccgcaatgtgctaccgtagttgttgtttatttgaaaacaattttttcctatttattttcgaaatttttcccctattttccgtccagttttcagattaaaatcgatatttttgattgcagattcacaaaatgaatcaatcagcggatgcgaaaccgccgaaggtaatcattaaaaacctttgatttttggcaatttgtcattttaaaatttaaaatttaaaatatatattttaaatattttcagccggatggacgagttacacgatcagtaacagttcgaaagctcggtccgggcgctaataaagaaaaacaggaatccgataattcgcaaaaaaagaaaaccgtcaacgcagcagctcaaaaagctgacacttcatccaaaaggaattcgggaaacccccaaaaaccaaaaaaacccaagcatgaagcaataaaagtgtcaactcgtcgactctctgcatcgtcgaaaccgccaccaccagctccacaaaatgtcccgaaaatgaattctttcgttgggaacgggaacactcgtatgattatggttcaaacgacgccacaggcgaaaaaactggaagctgagatgaagctgaggatgcagaacaagggtgaatctccagaagcgtcacttcttgtgctggaaagtcgcacgccagaaccgaccgttcagcaggttcttgaggagttgcagaatgatgttgtggtgagaaaatcccgaatttttcatgaaaatggatatcattttcagaatccaaaatcttccactactccagaaggctatagctttgaacttcgcaatctcaaaaccccagaggttactgaaaaccccaaattggcctgaaaaaggtcaaattttgacaaaaaactgtaatttttcagattcccgcgatgccaactccactggcttgctcgcctgcagctgccagaaattctccagtcgtgaaaaagattcagaaccacgtattcttgataaataattcatttatttccaaaactgccgattttcaggtcccaaacgtgactcttgtcccgtctgaacccagggagccgtcgctgagaaagtgcgcgagctttccgaaaatggattcgccgactattcataaaattctg