Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W05H12.2   

sjj_W05H12.2 RNAi JA:W05H12.2
Simmer:W05H12.2:Repeat_b
Simmer:W05H12.2:Screen_A
Simmer:W05H12.2:Screen_B
PCR_productsjj_W05H12.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW05H12.2 Source_evidenceePCR785WS150 Sequence/Annotation Release
Overlaps_Gene W05H12.2 Source_evidenceePCR785WS150 Sequence/Annotation Release
Chunk_score Abs_score764
Max_abs_score764W05H12.2
Specificity_index0.927
Rel_score1
Map_statusUnique_ePCRI1341163513412623
Y105C5A.14 Chunk_score Abs_score60
Specificity_index0.073
Rel_score0.079
Overlaps_transcriptW05H12.2 Source_evidenceePCR785WS150 Sequence/Annotation Release
WB_DNA_textsjj_W05H12.2989ctccattgcgtacccattcttattatttcacaatacgttttcatgagcaaattgttttattgataatttgttaatacaattgattaatacgaaaaaaaatgcatttgctggttcagccaaggagtaagtcgtattagttctgaaaaattaatgtgtttctgattgaaaaaaagagcaggaacaattaatgttctcgtcataaatgtgatggagaatgactgcatccatgcaagcatagtggatttggtcgatgcgaagtacttccctgacccaatcgctgagggattcctccttattgaggataataccggtaacctccagagccaattgtttcagcgaaggcattgatcttggttgcaggttcaggactcgatcgggtggaagaagagtctccattccaaagacggcaaatgttcttgtttgcccaagctgagcaatgaaatggtggattcttcgaagttctggttcgtttgtcttgtggatacgccaaagcacaattgtctgggtatcaatgtcgcagaacgtcaacagagccaacctatccctatgacgaacgggaaaatgtgcggattccgtgtcgaagaagattggtagagtgcgttgacgattgaatggtgccaagaatctgttcgcttcgaagaagttttccgtgattcgaattgtgaagtttgcgagttgtggatattgaattgtgttgtctcttgccaatcccaaagattcaataccgtgaatggatgtataatgagcacgggctccattgatgacaacatcctcgagtgctctccaagcattatctggtcttgagcttgcaacatctgtaatcctttccagaagccaaaatggatccactctgtgaaatcctccatttttgtgcacaatgcggatgagatccaaaattgcaccaatagacggaaaatagtttaaataatcttcttaatactttttgattatgtcatccataatatggattccatatagcagaacgcgtg