Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W06D4.4   

sjj_W06D4.4RNAiJA:W06D4.4
PCR_productsjj_W06D4.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene W06D4.4 Source_evidenceePCR790WS150 Sequence/Annotation Release
Chunk_score Abs_score706
Max_abs_score706W06D4.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI90621699063274
Overlaps_transcript W06D4.4.2 Source_evidenceePCR789WS150 Sequence/Annotation Release
W06D4.4.1 Source_evidenceePCR790WS150 Sequence/Annotation Release
WB_DNA_textsjj_W06D4.41106tgagcaactgcttcacgaacaaaagactcatcgaaaattattttctcttcgtgttcgaaatcaaatttgaaggcaacgatcggctcggatagttctcgaaattcgtgggttttcatttcagatagttgaacatcgaatacagccgcagttccagaacatcttcccaggggttcttcatctgaaaattttcaattctcataaaatccaaaaaaatgaagcctctctgaacctttttctccatttagcctaggaatatcattgaacatttttaacagatggctctccacaggaacaatatacacatttccagttgatggaacaactcgacatcctggtttcgcaagtctttcaagagcttctttgaatgttctcagagctccttctccaattaattctgtgtcaaatacctctgctacaatgatatctgcacgtgaaccaccaatttgtgaaacatcagtagatctctcagaaattacagtaatcttatctgaccatggactattgcttgttatatgtcttgcacaatctcccattggtttgaaaacttccaatgcagtcactttatcagctccttctcgagcagccattagtgaaagaagtccagttccagtacctgtaaatagtaaactttaaaaaccgaataagttgaaaacttaacagctaaccaatatctaaaacatgaactttcccatctgtattttcatgttttttctcagcaatcgtagtttttaatcctgcgaggaacttgtcatttctatcaaaatccagaatcatatctccaaatcgacttctgaaaattaacgttttaaagcaagaaaatgcgagaagtattgtttattaaattttatttctatgcggaatatttttttaaagttgaaaacctggcaagttcctgagccatatcataatcctcttcagccacaacccattctcgttcgccggttttttgatttatcttctcaaggaacatttttcagaaaaccctgcaaattgtctatcttaaagatatgctcgttttaatgatacactcaagatatttgcgatatgcacacaactgccaatttaccactttaaaatccaaagaaacgaaatcaaggaacggaaga