Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W06E11.1   

sjj_W06E11.1 RNAi JA:W06E11.1
Simmer:W06E11.1
PF:GL1_1G6
PCR_productsjj_W06E11.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW06E11.1 Source_evidenceePCR771WS150 Sequence/Annotation Release
Overlaps_Gene W06E11.1 Source_evidenceePCR771WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIII642082643743
Overlaps_transcriptW06E11.1 Source_evidenceePCR771WS150 Sequence/Annotation Release
WB_DNA_textsjj_W06E11.11662gtgcttctgacgacgaacaagagcaaattattcgaaaacttgtcaaaaaaccggaatttctatcagatgaagaggatgattcagttgaagatcaagtcgtttgggaatgcgacgtagttgtgtgcaattccacaccaaatactgaaatgttctctgtttcgtatccttcgagcaaacgagacgcctgggatgcaaagcgatttccaattgccagatataagaagaatgttcgattggtacggaaaaacacttgaaattggcttgaattcattgaaaatcggaaaataggacactagaattattgaacaaattgaacaaatcctgtcaaacgtttagagaaatgcccaaaaacatctgaaaaagtagccgtttttttcacaatttaatcaattttagatcgaattttcaatgtcactgattttcagctagaaatgcgcttcatgacagacacccaactcggatcatatgacaaaaagaaggcagaacttatgtatatggatggagatgtcccgaaaaaaggacatggaattgagtaggttttaccacagtttttgatgctgaaagtatgaaaatacacctgaaatttgctttgaaaaaagtagaaggtaaagaatatatttagcagacctatagttggtctgctaaatatttagcagaccaatgaggttgggtctgctaaatatttagcagattaattttgggtctgctaaataattagcagaccaattttgggtctgctaaatatttagcagacccatggttggtctgctaaacaattagcagaccaatgaggctgggtctgctaaatatttcgattaaaattcgaggattttcaaagaatttacagatttctttcgttttttaaatgaaaagttcaataaaatgctttcggtttgtagcaaaaaacgtagaaaaatcaatttttgaggcttaatgcggagtttttttgaaatttggtctgttaaataattagcagaccaaaagggttgggtctgctaaatgtttcgattgctaatcgagggtagggacagatttacagatttcttgcgttttttgaaaaaaaattgatttaaaaaattgctaattaattcgttacatttgttgaaaaaagagtagaaaaatcaattttaagtcagtgttttttaaaatttgatctgctatccacttagaagagcctagtttcgaattttcattcgaaaattgtgtgtttttcacataatttcaattcttccagtgctctccgagccaacgatgagatctacgaaggccgtgcattcatccacgatcacccaatagtcaatgcaattggattttttaaaaacggcgaattcttcattcatccgctgactggagcattcgaaatgcatcgatcaattcaagggttgaataaaaagaagaaatccgacggaaaatctggaaaatccgatgaagattcgtctggagaagaagaagacgttaagccatcctccgccgcagttagagtcaaattttctcggcctgaaactgaacgacaaaaaaaacgacgagaagcatcggcgttacatcgagagaaaaagattgcaagtgatatgtggattccgatgaaagttcatttgaaagatggtgaccctgtcgctgaaaaaattgatggaattagtcagaatggactccttttggacgatc