Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W06F12.1   

sjj_W06F12.1 RNAi JA:W06F12.1
Simmer:W06F12.1
PCR_productsjj_W06F12.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS W06F12.1a Source_evidenceePCR848WS150 Sequence/Annotation Release
W06F12.1c Source_evidenceePCR848WS150 Sequence/Annotation Release
W06F12.1d Source_evidenceePCR848WS150 Sequence/Annotation Release
Overlaps_Gene W06F12.1 Source_evidenceePCR1165WS150 Sequence/Annotation Release
Chunk_score Abs_score1123
Max_abs_score1123W06F12.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1372162413723296
Overlaps_transcript (7)
WB_DNA_textsjj_W06F12.11673ttttcacagtagacacccgaagtttaataatagttttaattaatttccaaaaataaaaaaattgaaaattcccacattcaacatggaaatctagattttttaaatctgaaatttctcaaaaatatccaatttttccaatatttccaattttgcaggactaaaatatttgcacactgcaaacatcctgcatcgagacatcaaaccgggaaatctcttagtcaacagcaattgcattttaaaaatttgcgattttggactcgctcgaacctgggaccaacgtgaccggctcaacatgacacacgaggttgtgacccagtactatagagccccggagttgttaatgggcgcgcgaaggtatacgggagccgtggatatttggtccgtcggttgcatatttgccgagctgctacaaaggaaaattctatttcaagccgccggtccgattgagcagctgcaaatgattatcgatttattgggaaccccatcgcaagaggctatgaaatacgcttgtgagggagccaagaaccatgtgctccgcgccggtcttcgagctcctgacacacagaggctgtacaagatcgcatcgcctgatgataagaatcacgaggcggtggatttactgcagaagcttctgcacttcgatccggataagagaattagtgtggaggaggcactgcaacatcgatatttagaagaagggcgtctgcgattccactcgtgtatgtgctcgtgctgctatacgaaaccaaatatgccgtcgaggttgttcgcgcaggatttggatccacgtgtaagttttaaagttttttttaaccaaaaaattataaattttcgatgaaaatcgttctaattttcttaacaaaaaattgatcttcaaaaaaggtaggtaattgataatttcccctcgcgtaattaaataaaaacataaaaattcgaacaaaaattgtaaattttttaataaaaaatttttttttccaaaataaatatttgaaaaagcgaaaattttcgtttttttcgtgagaaatcagaaattcccaatttgtcgaatacctatataagttgcgaattttttagatctcaatttttgccatggaatcaatagattaaaaaaaaaactttttctaatcgctttcaaatttacagcacgagagcccattcgatccaaagtgggagaaggacatgtcccgactatcgatgtttgagctccgcgagaaaatgtaccaatttgtgatggacaggcctgcgttgtacggtgtcgccctttgcataaatccccaatcggcggcctacaagaactttgcaagctcgtcagttgctcaggcctcagaattacctccatcaccgcaggcttggtgacaaaaaaatgattattgatttatattccatttgttagcctcttcaactcaccaataatcattttcagtcgtctcgccgtttgctttttctgtggattgccccacgtgtaattattgattggcaaatcgcgtcccccgccactctatgagctttttatgtgatccttcaacaaaagttttttgaaatatcccatttagttattgattttcctattcttcttgtgattgtgctggtcgcttttgcatcaaaagtgcgtcttctcttcttcttaaaggtgcccctctttcaaaacaaaaaatgccacagttctttcaaaa