Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_W06G6.12   

sjj_W06G6.12RNAiJA:W06G6.12
PCR_productsjj_W06G6.12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS W06G6.12 Source_evidenceePCR771WS150 Sequence/Annotation Release
Y70C5B.1 Source_evidenceePCR513WS150 Sequence/Annotation Release
Overlaps_Gene W06G6.12 Source_evidenceePCR771WS150 Sequence/Annotation Release
Chunk_score Abs_score624
Max_abs_score624W06G6.12
Specificity_index0.617
Rel_score1
Map_statusBest_ePCRV1665420816656201
Y70C5B.1 Source_evidenceePCR513WS150 Sequence/Annotation Release
Chunk_score Abs_score387
Specificity_index0.383
Rel_score0.62
Map_statusTop50_percentile_ePCRV1666442516666418
Overlaps_transcript W06G6.12 Source_evidenceePCR771WS150 Sequence/Annotation Release
Y70C5B.1 Source_evidenceePCR513WS150 Sequence/Annotation Release
WB_DNA_textsjj_W06G6.121994tgcaaaaatgttctgatcaaatgttgaaagataaaaaaagcaaaagatcgaaaattggaaagaaattcagaagtttacagatacaaatgaaaaatatattcttggtgctcactacgacactccaatatcctaaggccctgaccaatcagcgacataggccacgccccccgtccgtcgctgattgaatctcttttgcgcggaaattcaaatttttgggaaaacatcggaatgtcattggtaaccacaaaaaaagggaaaaaggtccaaaatcaatcaattaaacaacacccactcattgggttttgggacgaaatttccatttccaaccaatcggaaacacttgttcacaccataaacctctggcattgggtagggaatgtcccagaaaagctgaaatttttaatactataggttttcagatttttcttaaaagtgaaaatttcctacccaggatttgaaaaattgtccgttattgcctgggtattccggtgtgtttgaaagggagctaggaagcatttgactctataaatttagactttcaataaattttttggaatacttttttcaactacctctatctgatttttctgatccaaataatctgacaaggctcggacctgagctgcctgaaatttttccacggcgttgacctgaaatgtgttgagaacgataattgctatttatgttgagggaggtgccaaccaatcagcgatgtaggccacgccttctgtacatcgctgattagtcctcgtttgcgcgggaaacgaacttacaacaatcaaatagttcttgaattcaaacgcatcggtgaccaaagaaaaagccacatgggctttaactctgcaattgcaattgggacaagtgtggtgctcctgtgaactcattcttttgctcaccctgaaaactggtaattctcaaagtgagcacaatggacccatcaagcttaccaataggcacaacattcccaatgagcaaaaactaggtacttgtctgttggcgggtagaactcgtccacgtcgatttccaactgaaaataaaacttaaatttgaattctgtataataaaatacactttgactcaccgtttgcaatttttcagaagttttgaaaaataatagcattgtacaaagcttgagctgaagctgaagctacagaaacttctgaacagaaaaaagatctagatcaaatattagacaccgtaaaaaacgagttcagcacgagctttcagaaactataaaaccaaacgattaaatttattttttacagtcaatcaattagttattatcttcctcctcctcagattcggacatgtttccaggccgtcccagacccattgctctcatcatcatctgaataaaatattgctaaagcagactcttaatctcgcgcttggatgaaaatagatccgaccaatcagagacgtaggccacgcccactgttcgccgccgattggtcgtcctgatatttgcgcgtcatgaaattatcaaaatgttacccgcatccgaacctaatgagggtaatcctctgcctctctctgaacctgttggatgaactcctgcgagaatcggggctcgacggcagcgaccttgatctctccgagcccgatcttgagctcatcggcagccaagtgatcctctatgccgacagctccatcagcaatatccatctcctcgtcggtgtcatcagaaactgagtgagtcgattcagcatcggaatagtccactgcttcgctcattcctcccagtgattccgcttcttgatcgggatcaacttccatctggaaattcggattttagatagcgaagtcatagcctaaactttaacctaagcctatgtctaagccgaaaccgaggcgtaagccaaagcctaacataatcttaagtcgacgcctaggcggaagtaaaagcttaaacttttgaagtgtggaaaaatcctcgtaaaaaccttactttcgtcctagtagtgtagttgtagaaatcgcaattgtaatctgga